Atriplex vesicaria

Heward ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records13 353

Data sources11

Biological traits38

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Atriplex vesicaria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 353 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Occurrence & distributionGBIF13 353 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · TreeOfSex1.5 Gbp

01Narrative

Habit (subsp. macrocystidia) near Balranald A macro image of an Atriplex vesicaria fruit and leaf Atriplex vesicaria, commonly known as bladder saltbush, is a species of flowering plant of the family Amaranthaceae and is endemic to arid and semi-arid inland regions of Australia. It is an upright or sprawling shrub with scaly leaves and separate male and female plants, the fruit often with a bladder-like appendage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length8.5 mm

Fruit width8.5 mm

Leaf length25 mm

Leaf length max25 mm

Leaf mass5.5 mg

Leaf mass per area167 g/m2

Leaf size28.75 mm²

Leaf width3.75 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 0.5 m

Plant height max1 m

Plant height min0.3 m

Seed mass1.39 mg

⚠ sources differ — TRY: 1.39 mg · AusTraits: 1.49 mg · GIFT: 3.81 mg

Seed mass max15.08 mg

Seed mass min0.736 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnnynnnn

Life formsubshrub

Life spanperennial

Lifespan years32 years

⚠ sources differ — TRY: 32 years · AusTraits: 25 years

Pollination syndromewind

Resprouting capacityfire_killed

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical oblong obovate

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Specific leaf area (SLA)6.17 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex vesicaria has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF828443.1 ↗441 bpAustralia · 2011

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGACGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Atriplex vesicaria voucher T11_SMPRS 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Atriplex vesicaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 462 110 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atriplex vesicaria1.46 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 183×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · TreeOfSex · plant

CCDB · ipcn-api-dl — NOBS, M. A. 1978. Chromosomal numbers in Atriplex. Carnegie Inst. Wash. Year Book 77: 240–241.

CCDB · book-ipcn75-78 — Nobs 1978

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 353 records

Wild obs. + sensor10 697

Museum / vouchered2 647

Other9

Origin

Native8 289

Range

Area of Occupancy AOO26 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 6 861≤1 km 2 553≤10 km 826>10 km 17

10 257 georeferenced · 440 without coordinates

Open the mapobservation + sensor10 697

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 568≤1 km 699≤10 km 884>10 km 332

2 483 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence2 647

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	1 358
Kensington, AU	287
Mount Annan, AU	211
Palmerston, AU	136
Canberra, AU	105
Museo Entomologico de Leonlocation not on record	91
Brisbane, AU	64
Hobart, AU	16
Armidale, AU	16
NSW Dept of Planning, Industry and Environmentlocation not on record	12
John T. Waterhouse Herbariumlocation not on record	11
CASlocation not on record	9
Guangzhou, CN	4
BGPAlocation not on record	3
Stockholm, SE	3
MAlocation not on record	3
Claremont, US	2
Smithfield, AU	2
NSW Office of Environment and Heritagelocation not on record	1
Wlocation not on record	1
MeiseBGlocation not on record	1
JBRJlocation not on record	1
University of Stellenboschlocation not on record	1
Joondalup, AU	1
Flagstaff, US	1
Australian Museum, Sydneylocation not on record	1
Wellington, NZ	1

27 institutions · 2 342 of 2 647 vouchered records shown · 305 without an institution code

09Environmental DNA1 detections

Where the DNA of Atriplex vesicaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 9.80–9.80

Seasonal swing summer↔winter16.3 °C

Max temp (day)14.6 °C

Min temp (night)5.70 °C

Precipitation24.6 mm/mo

Air humidity57.3 %

Moisture balance-32.8 mm/mo

Vapour deficit516 Pa

Wind speed3.80 m/s

Cloud cover16.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atriplex vesicaria

At a glance

Sources11 archives

Size & morphology14

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type13 353 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 353 records