Atriplex sturtii

S.W.L.Jacobs · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records245

Data sources5

Biological traits24

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Atriplex sturtii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility245 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF245 records

DNA & barcodingNCBIsequences

01Narrative

Atriplex sturtii, commonly known as saltbush, is an endangered species within the widespread genus Atriplex. A. sturtii is a native Australian shrub and grows in the Channel Country bioregion, also referred to as 'Corner Country'.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology8

Leaf length15 mm

Leaf length max15 mm

Leaf width6.5 mm

Plant height0.15 m

⚠ sources differ — GIFT: 0.15 m · AusTraits: 0.3 m

Plant height max0.15 m

Seed mass0.18 mg

⚠ sources differ — TRY: 0.18 mg · AusTraits: 0.583 mg · GIFT: 0.18 mg

Seed mass max0.18 mg

Seed mass min0.18 mg

Life cycle & reproduction4

Life formannual or perennial

Life spanannual

⚠ sources differ — TRY: annual · AusTraits: annual short_lived_perennial · GIFT: annual

Raunkiær life formtherophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf shapeobovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex sturtii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM180321.1 ↗590 bp

ACGT

CGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTAGGGGTGAAAGCCCCTTCCTCGAGCGGGGGAATCGCTAC …

Atriplex sturtii voucher chen 910 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type245 records

Wild obs. + sensor197

Museum / vouchered46

Cultivated / captive2

Origin

Native67

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 189≤1 km 7

196 georeferenced · 1 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 12≤1 km 11≤10 km 6>10 km 1

30 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence46

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	16
Museo Entomologico de Leonlocation not on record	9
Palmerston, AU	7
Canberra, AU	6
Kensington, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Brisbane, AU	1
Adelaide, AU	1
Armidale, AU	1

9 institutions · 46 of 46 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)