Atriplex rosea
speciesAt a glance
Occurrence records3 252
Data sources12
Biological traits41
DNA specimens15
eDNA detections10
Sources12 archives
Databases and archives Atriplex rosea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 252 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Occurrence & distributionGBIF3 252 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex978 Mbp
01Narrative
Łoboda gwiazdkowata – gatunek rośliny w różnych systemach klasyfikacyjnych włączany do rodziny komosowatych lub szarłatowatych. Pochodzi z Afryki Północnej, Azji Zachodniej oraz południowej, południowo-wschodniej, wschodniej i środkowej Europy. Rozprzestrzenił się również na innych kontynentach. W Polsce występuje na nizinach.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology14
Fruit width2 mm
Leaf length max35 mm
Leaf mass21.0 mg
Leaf size365 mm²
Leaf width28 mm
Leaf width max28 mm
Leaf width min28 mm
Plant height0.395 m
Plant height generative0.39 m
Plant height max1 m
Plant height min0.25 m
Seed mass2.48 mg
Seed mass max3.28 mg
Seed mass min1.4 mg
Life cycle & reproduction12
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typehuman
Flowering endSep
Flowering startJul
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Seed number1 817
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation min500 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTLowland
Mycorrhiza type0.000139884
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)235 mg/g
Photosynthetic pathwayC4
Specific leaf area (SLA)18.64 mm²/mg
Other traits1
Diaspore typeseed
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex rosea has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes5
GenBank sequences10
eDNA detections10
Countries5
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCTCCCCCCACCACCATGTGTGGAAGGGGCGGAGGATGATGGCCTCCCATGCCTCACCGGGCGTGGATGGCCTAAATAAGG …
Atriplex rosea voucher ZX-5585 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Atriplex rosea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size978 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Atriplex rosea0.98 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–182n range18median18mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1825×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl +11
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Estudio cariolgico del gnero Atriplex (Chenopodiaceae) en Andaluca Occidental. Juan, R. & J. Pastor.Lagascalia16(1): 3-14(1990).
CCDB · mediterranean
CCDB · ipcn-api-dl — Fukui, K. & Y. MUKAI. 1988. Condensation pattern as a new image parameter for identification of small chromosomes in plants. Jap. J. Genet. 63: 359–366.
CCDB · ipcn-api-dl — Krahulcová, A. 1988. Selected chromosome counts of the Czechoslovak flora I. Folia Geobot. Phytotax. 23: 375–381.
CCDB · ipcn-api-dl — Juan, R. & J. Pastor. 1991. Estudio cariológico del género Atriplex (Chenopodiaceae) en Andalucía occidental. Lagascalia 16: 3–14.
CCDB · ipcn-api-dl — Kliphuis, E. & Y. I. Barkoudah. 1977. Chromosome numbers in some Syrian angiosperms. Acta Bot. Neerl. 26: 239–249.
CCDB · book-ipcn67-71 — BASSETT, I.J., & c.w. CROMPTON. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442.
CCDB · book-ipcn75-78 — Kliphuis & Barkoudah 1977
CCDB · book-indian_vol1 — Wulff, H.D. 1936; Mulligan, G.A. 1957 ; Bassett, I.J. & Crompton, C.W. 1970
CCDB · eflora
CCDB · book-fedorov — Wulff 1936
CCDB · book-fedorov — Mulligan 1957
CCDB · Cave1957 — Mulligan
CCDB · CromoCat 2015 — Bassett, I. J. & C. W. Crompton. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVII]. Taxon 19(3): 437.
CCDB · CromoCat 2015 — Fukui, K. & Mukai, Y. (1988). Condensation pattern as a new image parameter for identification of small chromosomes in plants. Jap. J. Genet. 63: 359-366.
CCDB · CromoCat 2015 — Grozeva, N. (2010). Reports (1715-1721). In: Kamari, Blanché & Siljak-Yakovlev (eds): Mediterranean chromosome number reports-20 Fl. Medit. 20: 266-272
CCDB · CromoCat 2015 — Juan, R. & Pastor, J. (1990). Estudio cariológico del género Atriplex (Chenopodiaceae) en Andalucía Occidental. Lagascalia 16(1): 3-14.
CCDB · CromoCat 2015 — Kliphuis, E. & Barkoudah, Y. I. (1977). Chromosome numbers in some Syrian Angiosperms. Acta Bot. Neerl. 26: 239-249.
CCDB · CromoCat 2015 — Krahulcová, A. (1988). Selected chromosome counts of the Czechoslovak flora I. Folia Geobot. Phytotax. 23: 375-381.
CCDB · CromoCat 2015 — Mulligan, G. A. (1957). Chromosome numbers of Canadian weeds. I. Canad. J. Bot. 35: 779-789.
CCDB · CromoCat 2015 — Wulff, H. D. (1936). Die polysomatie der Chenopodiaceen. Planta 26: 275-290.
CCDB · iapt — IAPT/IOPB Chromosome Data 27
TreeOfSex · plant — Goldblatt1979 ↗
n 96×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 528-543. Pastor Daz, J., I. Fernndez & M. J. Dez.Lagascalia15(1): 124-129(1988).
CCDB · ipcn-api-dl — Pastor, J., I. Fernández & M. Díez. 1988. Números cromosómicos para la flora Española. 528--543. Lagascalia 15: 124–129.
CCDB · ipcn-api-dl — NOBS, M. A. 1975. Chromosome numbers in Atriplex. Carnegie Inst. Wash. Year Book 74: 762–765.
CCDB · book-ipcn75-78 — Nobs 1975
CCDB · CromoCat 2015 — Pastor, J., I. Fernández & M. Díez. (1988). Números cromosómicos para la flora española, 528-543. Lagascalia 15(1): 124-129.
TreeOfSex · plant — Goldblatt1979 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 252 records
Wild obs. + sensor1 566
Museum / vouchered1 662
Other24
Origin
Native54
Introduced73
Range
Area of Occupancy AOO8 820 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy17% within 1 km
≤100 m 61≤1 km 154≤10 km 1 024>10 km 41
1 280 georeferenced · 286 without coordinates
Open the mapobservation + sensor1 566
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 70≤1 km 322≤10 km 338>10 km 23
753 georeferenced · 909 without coordinates
Open the institutions mapphysical evidence1 662
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions105 of 171 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| MAlocation not on record | 92 |
| Bronx, US | 78 |
| Claremont, US | 75 |
| LDlocation not on record | 66 |
| San Diego, US | 53 |
| Riverside, US | 48 |
| Santa Barbara, US | 42 |
| Pullman, US | 39 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 34 |
| Corvallis, US | 33 |
| Berlin, DE | 31 |
| Davis, US | 31 |
| Flagstaff, US | 31 |
| València, ES | 28 |
| Moscow State Universitylocation not on record | 28 |
| Christchurch, NZ | 26 |
| Canadian Department of Agriculturelocation not on record | 24 |
| Oskarshamn, SE | 23 |
| Uppsala, SE | 21 |
| Vancouver, CA | 21 |
| Museo Entomologico de Leonlocation not on record | 21 |
| Vitoria, ES | 20 |
| BIO-UNIPIlocation not on record | 19 |
| Görlitz, DE | 18 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 18 |
| Provo, US | 17 |
| Philadelphia, US | 17 |
| BClocation not on record | 16 |
| US | 15 |
| WTUlocation not on record | 15 |
| Barcelona, ES | 14 |
| ASUlocation not on record | 14 |
| Moscow, US | 14 |
| Chongqing Museumlocation not on record | 13 |
| MeiseBGlocation not on record | 13 |
| Logan, US | 13 |
| San Sebastián, ES | 13 |
| San Luis Obispo, US | 13 |
| Salamanca, ES | 12 |
| Mlocation not on record | 12 |
| Arcata, US | 11 |
| Alicante, ES | 11 |
| Jaén, ES | 10 |
| BFLlocation not on record | 10 |
| GJOlocation not on record | 10 |
| PRClocation not on record | 9 |
| Henderson, US | 9 |
| Phoenix, US | 9 |
| CJBGlocation not on record | 8 |
| Missoula, US | 8 |
| Boise, US | 8 |
| Albuquerque, US | 8 |
| Uniwersytet Wrocławskilocation not on record | 8 |
| Mexico City, MX | 8 |
| Saint Louis, US | 8 |
| Irvine, US | 7 |
| Madrid, ES | 7 |
| Tampa, US | 7 |
| BDBClocation not on record | 7 |
| Auckland, NZ | 7 |
| Granada, ES | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Wuzhou, CN | 6 |
| BRNUlocation not on record | 6 |
| Pamplona, ES | 6 |
| Pocatello, US | 5 |
| Eastern Nevada Landscape Coalitionlocation not on record | 5 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| Bloomington, US | 5 |
| Wlocation not on record | 5 |
| Castelar, AR | 4 |
| CASlocation not on record | 4 |
| EEZA-CSIClocation not on record | 4 |
| San Isidro, AR | 4 |
| Bozeman, US | 4 |
| Paris, FR | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Pretoria, ZA | 3 |
| Spearfish, US | 3 |
| Olocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Caldwell, US | 3 |
| Fulda, DE | 3 |
| Denver, US | 3 |
| La Paz, MX | 3 |
| San Francisco, US | 3 |
| Staten Island, US | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| UChlocation not on record | 3 |
| IDElocation not on record | 3 |
| Durango, US | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| Ensenada, MX | 3 |
| Corrientes, AR | 2 |
| Sion, CH | 2 |
| Bangkok, TH | 2 |
| Madison, US | 2 |
| Brookings, US | 2 |
| Helsinki, FI | 2 |
| Pamplona, ES | 2 |
| EL PASO, US | 2 |
| Chadron, US | 2 |
| Dresden, DE | 2 |
| Tilburg, NL | 2 |
| Los Angeles, US | 2 |
| Bourges, FR | 2 |
| Bern, CH | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Salzburg, AT | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| Acadia Universitylocation not on record | 2 |
| GZUlocation not on record | 2 |
| Beijing, CN | 2 |
| Austin, US | 1 |
| JBSlocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Córdoba, AR | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Hobart, AU | 1 |
| Rotorua, NZ | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Mexico City, MX | 1 |
| Northridge, US | 1 |
| Bend, US | 1 |
| Turku, FI | 1 |
| Wellington, NZ | 1 |
| Millersville, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| San Bernardino, US | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Cslocation not on record | 1 |
| San Jose, US | 1 |
| AUAlocation not on record | 1 |
| VALElocation not on record | 1 |
| Dekalb, US | 1 |
| New Brunswick, US | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Burlington, US | 1 |
| Tuscaloosa, US | 1 |
| Badajoz, ES | 1 |
| Philadelphia, US | 1 |
| University of Johannesburglocation not on record | 1 |
| Stockholm, SE | 1 |
| Tacoma, US | 1 |
| NMBU:MINAlocation not on record | 1 |
| Santa Cruz, US | 1 |
| Angwin, US | 1 |
| sonstHerblocation not on record | 1 |
| Durango, MX | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Orem, US | 1 |
| Davenport, US | 1 |
| Valparaiso, CL | 1 |
| INFlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Juriquilla, MX | 1 |
| Chapingo, MX | 1 |
| Córdoba, ES | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
171 institutions · 1 538 of 1 662 vouchered records shown · 123 without an institution code
09Environmental DNA10 detections
Where the DNA of Atriplex rosea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
disturbed|granitic|Phenology=FFL
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.7 °C 11.9–22.6
Seasonal swing summer↔winter18.7 °C
Max temp (day)23.1 °C 16.3–30.2
Min temp (night)16.2 °C 8.80–17.0
Precipitation25.8 mm/mo 10.6–77.6
Air humidity54.4 % 49.4–60.8
Moisture balance-66.1 mm/mo
Vapour deficit1,014 Pa 638–1,383
Wind speed2.90 m/s
Cloud cover23.3 % 10.3–46.1
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.