Atriplex patula
speciesAt a glance
Occurrence records188 351
Data sources13
Biological traits56
DNA specimens52
eDNA detections29
Sources13 archives
Databases and archives Atriplex patula's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility188 351 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics52 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources56 traits
Occurrence & distributionGBIF188 351 records
Environmental DNA1 datasets · 6 countries29 detections
DNA & barcodingBOLD · NCBI52 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2 Gbp
01Narrative
Atriplex patula, l'Arroche étalée est une espèce de plantes herbacées de la famille des Amaranthacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology19
Fruit length2 mm
Fruit width2 mm
Leaf length70 mm
Leaf length max70 mm
Leaf mass72.63 mg
Leaf size1 104 mm²
⚠ sources differ — LEDA: 1 104 mm² · GIFT: 1 222 mm²
Leaf width40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 22 mm
Leaf width max22 mm
Leaf width min22 mm
Plant height0.988 m
⚠ sources differ — GIFT: 0.988 m · AusTraits: 1.1 m · LEDA: 0.988 m · TRY: 0.839 m
Plant height generative0.635 m
Plant height max1.5 m
Plant height min0.1 m
Seed length2.18 mm
⚠ sources differ — TRY: 2.18 mm · GIFT: 2.8 mm
Seed length max2.8 mm
Seed length min2.8 mm
Seed mass1.36 mg
⚠ sources differ — TRY: 1.36 mg · LEDA: 3.21 mg · GIFT: 1.89 mg
Seed mass max2.15 mg
Seed mass min0.98 mg
Life cycle & reproduction15
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flowering endSep
Flowering startJul
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number3 050
Self fertilizationpresent
Sex typemonoecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nutlet · GIFT: achene
Growth formherb
Habitat GIFTdump, rivers, roadsides
Leaf compoundnesssimple
Leaf shapenarrowly_elliptical
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)164 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)17.47 mm²/mg
⚠ sources differ — TRY: 17.47 mm²/mg · LEDA: 16.2 mm²/mg · GIFT: 17.38 mm²/mg
Other traits2
Diaspore typegenerative dispersule
Seeds per fruit>1000
05DNA & barcoding52 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex patula has left across the world's sequence archives.
At a glance
DNA specimens52
Marker genes8
GenBank sequences10
eDNA detections29
Countries8
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATC …
Atriplex patula voucher JAG 0290WP 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Atriplex patula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 953 555 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Atriplex patula1.95 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records18–362n range36median36mode65records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3654×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +18
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt
CCDB · brit-fl — Jones, E.M. Watsonia 10: 233-251 (1975)
CCDB · brit-fl — Hulme, B.A. (1957)
CCDB · brit-fl — Taschereau, P.M. (1979)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. X. Chenopodiaceae. Queirs, M.Bol. Soc. Brot. ser. 249: 121-142(1975).
CCDB · iber-fl — Estudio cariolgico del gnero Atriplex (Chenopodiaceae) en Andaluca Occidental. Juan, R. & J. Pastor.Lagascalia16(1): 3-14(1990).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1831
CCDB · poland — Mizianty M., Frey L. and Mirek Z. 1981. Contribution to the knowledge in the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 19-29.
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · mediterranean
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.
CCDB · ipcn-api-dl — Taschereau, P. M. 1985. Taxonomy of Atriplex species indigenous to the British Isles. Watsonia 15: 183–209.
CCDB · ipcn-api-dl — Hulme. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index.Cambridge Univ. Press. P. 19.
CCDB · ipcn-api-dl — Lomonosova, M. N. & A. A. Krasnikov. 1992. Chromosome numbers in the members of the genus Atriplex (Chenopodiaceae). Bot. Žhurn. (Moscow & Leningrad) 77(6): 99–100.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Uhrikova, A. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · book-ipcn72 — TASCHEREAU, P.M. 1972. Taxonomy and distribution of Atriplex species in Nova Scotia. Canad. J. Bot. 50: 1571-1594.
CCDB · book-ipcn67-71 — VAN DER MEIJDEN, R. 1970. Biosystematic notes on Atriplex patula L., A. hastata L. and A. litoralis L. (Chenopodiaceael. Blumea 18: 53-63.
CCDB · book-ipcn67-71 — BASSETT, I.J., & C.W. CROMPTON. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797"":"
CCDB · book-ipcn75-78 — Uhrikova 1974a
CCDB · book-northern-plants — Winge 1917.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · eflora
CCDB · book-fedorov — Winge 1917h
CCDB · book-fedorov — Cooper G. O. 19;)5
CCDB · book-fedorov — LOve A., Love D. 1956h
CCDB · kew — Band SR. (pers. comm. 1984).
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Lomonosova, M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:898
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Cooper, D. C. (1935a). Microsporogenesis and the development of the male gametes in Portulaca oleraceae. Amer. J. Bot. 22: 453-459.
CCDB · CromoCat 2015 — Hindakova, M. (1974). Index of chromosome numbers of Slovakian flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.
CCDB · CromoCat 2015 — Hulme, B. A. (1958). Artificial hybrids in the genus Atriplex. Proc. Bot. Soc. Brit. Isles 3: 94.
CCDB · CromoCat 2015 — Juan, R. & Pastor, J. (1990). Estudio cariológico del género Atriplex (Chenopodiaceae) en Andalucía Occidental. Lagascalia 16(1): 3-14.
+12 more references
2n 1811×GoaT · Tree of Sex Database · CCDB · iber-fl · CCDB · book-northern-plants +3
GoaT · Tree of Sex Database — ↗
CCDB · iber-fl — Estudio cariolgico del gnero Atriplex (Chenopodiaceae) en Andaluca Occidental. Juan, R. & J. Pastor.Lagascalia16(1): 3-14(1990).
CCDB · book-northern-plants — Witte 1947, Kjellmark 1934.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-fedorov — Winge Hl17a
CCDB · book-fedorov — Kjellmark 1934
CCDB · book-fedorov — Witte 1947
CCDB · CromoCat 2015 — Grozeva, N. (2010). Reports (1709-1714). In: Kamari, Blanché & Siljak-Yakovlev (eds): Mediterranean chromosome number reports-20 Fl. Medit. 20: 260-265
CCDB · CromoCat 2015 — Juan, R. & Pastor, J. (1990). Estudio cariológico del género Atriplex (Chenopodiaceae) en Andalucía Occidental. Lagascalia 16(1): 3-14.
CCDB · CromoCat 2015 — Kjellmark, S. (1934). Einige neue chromosomenzahlen in der familie Chenopodiaceae (Vort. Mitt.). Bot. Not. 87: 136-144.
CCDB · CromoCat 2015 — Witte, M. B. (1947). A comparative cytological study of three species of the Chenopodiaceae. Bull. Torrey Bot. Club 74: 443-453.
n 186×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1
CCDB · ipcn-api-dl — NOBS, M. A. 1975. Chromosome numbers in Atriplex. Carnegie Inst. Wash. Year Book 74: 762–765.
CCDB · book-ipcn67-71 — VAN DER MEIJDEN, R. 1970. Biosystematic notes on Atriplex patula L., A. hastata L. and A. litoralis L. (Chenopodiaceael. Blumea 18: 53-63.
CCDB · book-ipcn75-78 — Nobs 1975
CCDB · CromoCat 2015 — Nobs, M. A. (1975). Chromosome numbers in Atriplex Carnegie Inst. Wash. Year Book 74: 762–765
CCDB · CromoCat 2015 — Van der Meijden, R. (1970). Biosystematic notes on Atriplex patula L., A. hastata L. and A. littoralis L. (Chenopodiaceae). Blumea 18: 53-63.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Lomonosova, M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:898
n 91×TreeOfSex · plant
TreeOfSex · plant — Goldblatt1979 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type188 351 records
Wild obs. + sensor176 937
Museum / vouchered10 851
Cultivated / captive25
Fossil2
Other536
Origin
Native22 270
Introduced91
Range
Area of Occupancy AOO317 660 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy35% within 1 km
≤100 m 22 207≤1 km 33 082≤10 km 100 818>10 km 1 181
157 288 georeferenced · 19 649 without coordinates
Open the mapobservation + sensor176 937
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 837≤1 km 2 187≤10 km 3 125>10 km 1 120
7 269 georeferenced · 3 582 without coordinates
Open the institutions mapphysical evidence10 851
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 18
18 georeferenced · 7 without coordinates
Open the mapnot free-living25
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions163 of 266 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 552 |
| Helsinki, FI | 962 |
| BFLlocation not on record | 414 |
| LDlocation not on record | 408 |
| Olocation not on record | 370 |
| Moscow State Universitylocation not on record | 258 |
| Berlin, DE | 243 |
| DBF-NHMDlocation not on record | 206 |
| Uniwersytet Jagiellońskilocation not on record | 204 |
| MeiseBGlocation not on record | 183 |
| Uniwersytet Warszawskilocation not on record | 173 |
| SLU Artdatabankenlocation not on record | 166 |
| Philadelphia, US | 146 |
| Oulu, FI | 125 |
| Kuopio, FI | 124 |
| Turku, FI | 122 |
| Québec, CA | 119 |
| Oskarshamn, SE | 116 |
| Salzburg, AT | 98 |
| Bergen, NO | 94 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 92 |
| MAlocation not on record | 83 |
| Provincia di Livornolocation not on record | 82 |
| Tartu, EE | 78 |
| València, ES | 72 |
| Museo Entomologico de Leonlocation not on record | 65 |
| South Kensington, GB | 64 |
| Trondheim, NO | 62 |
| Görlitz, DE | 57 |
| BRNUlocation not on record | 56 |
| Uppsala, SE | 53 |
| Chongqing Museumlocation not on record | 50 |
| Vitoria, ES | 49 |
| Pullman, US | 48 |
| Barcelona, ES | 47 |
| Jyväskylä, FI | 46 |
| Mlocation not on record | 44 |
| Madison, US | 43 |
| BDBClocation not on record | 42 |
| Bern, CH | 42 |
| KMNlocation not on record | 41 |
| Université Lavallocation not on record | 40 |
| St. Paul, US | 39 |
| GJOlocation not on record | 39 |
| Bronx, US | 38 |
| Wellington, NZ | 37 |
| WINlocation not on record | 37 |
| Bloomington, US | 33 |
| Hobart, AU | 32 |
| Acadia Universitylocation not on record | 31 |
| New Haven, US | 30 |
| Wlocation not on record | 30 |
| Burlington, US | 29 |
| Saint John, CA | 28 |
| Ann Arbor, US | 27 |
| Tallinn, EE | 27 |
| Christchurch, NZ | 27 |
| Wuzhou, CN | 27 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 26 |
| CJBGlocation not on record | 25 |
| Victoria, CA | 25 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| TUR-Alocation not on record | 22 |
| Uniwersytet Śląski w Katowicachlocation not on record | 22 |
| Missoula, US | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 22 |
| Entomological Society of Latvialocation not on record | 22 |
| Montréal, CA | 22 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 20 |
| Salamanca, ES | 19 |
| Bozeman, US | 19 |
| Corvallis, US | 19 |
| GZUlocation not on record | 19 |
| Jaén, ES | 18 |
| Frankfurt am Main | 18 |
| College of the Atlantic, Museumlocation not on record | 17 |
| Chadron, US | 17 |
| Green Bay, US | 16 |
| BClocation not on record | 16 |
| San Sebastián, ES | 16 |
| Auckland, NZ | 14 |
| WTUlocation not on record | 14 |
| Saint Louis, US | 14 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 13 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 13 |
| Moscow, US | 13 |
| Denver, US | 13 |
| Mount Annan, AU | 13 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 12 |
| Fulda, DE | 12 |
| ISAlocation not on record | 12 |
| Dekalb, US | 10 |
| Granada, ES | 10 |
| Zürich, CH | 10 |
| Frauenfeld, CH | 10 |
| Vancouver, CA | 10 |
| Yangling, CN | 10 |
| Madrid, ES | 9 |
| Spearfish, US | 9 |
| TROMlocation not on record | 9 |
| College Park, US | 9 |
| Staten Island, US | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Forssa, FI | 9 |
| Badajoz, ES | 9 |
| Mexico City, MX | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Bangkok, TH | 9 |
| Podgorica, ME | 8 |
| Zürich, CH | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Museo Achille Folettolocation not on record | 8 |
| Toronto, CA | 8 |
| Whitehorse, CA | 8 |
| Paris, FR | 8 |
| Tilburg, NL | 8 |
| PrivatHerblocation not on record | 8 |
| Tampa, US | 7 |
| CICYTEXlocation not on record | 7 |
| Canberra, AU | 7 |
| Porrentruy, CH | 7 |
| EEZA-CSIClocation not on record | 6 |
| University of Stellenboschlocation not on record | 6 |
| Porvoo, FI | 6 |
| Pamplona, ES | 6 |
| Chapel Hill, US | 6 |
| Provo, US | 6 |
| Philadelphia, US | 6 |
| John May Museum of Natural Historylocation not on record | 6 |
| Nijmegen, NL | 5 |
| BSBIlocation not on record | 5 |
| Allentown, US | 5 |
| Umeå Universitylocation not on record | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| UIBlocation not on record | 5 |
| Chicago, US | 5 |
| BIO-UNIPIlocation not on record | 5 |
| Córdoba, ES | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Durango, MX | 5 |
| Claremont, US | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Stockholm, SE | 4 |
| US | 4 |
| SZUlocation not on record | 4 |
| Lincoln, US | 4 |
| Karlsruhe, DE | 4 |
| Dresden, DE | 4 |
| Phoenix, US | 4 |
| Taipei, TW | 4 |
| Whitewater, US | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Kew, GB | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Columbia, US | 3 |
| Emporia, US | 3 |
| Williamsburg, US | 3 |
| Davenport, US | 3 |
| Durham, US | 3 |
| Appalachian State Universitylocation not on record | 3 |
| ASUlocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Long Beach, US | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Flagstaff, US | 3 |
| National Museum Waleslocation not on record | 3 |
| PRClocation not on record | 3 |
| Caldwell, US | 3 |
| EL PASO, US | 3 |
| Durango, US | 3 |
| Sion, CH | 3 |
| Henderson, US | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| University of New Hampshirelocation not on record | 2 |
| Cape Town, ZA | 2 |
| Alicante, ES | 2 |
| Keene State Universitylocation not on record | 2 |
| Banyoles, ES | 2 |
| FLADlocation not on record | 2 |
| Córdoba, AR | 2 |
| San Isidro, AR | 2 |
| Pamplona, ES | 2 |
| Glarus, CH | 2 |
| Beijing, CN | 2 |
| Winterthur, CH | 2 |
| JBSlocation not on record | 2 |
| Philadelphia, US | 2 |
| Arcata, US | 2 |
| Xiamen, CN | 2 |
| GAlocation not on record | 2 |
| Tuscaloosa, US | 2 |
| CJBNlocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Montecillo, Texcoco, MX | 2 |
| Mississippi State, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Boise, US | 2 |
| Brookings, US | 2 |
| Gijón, ES | 1 |
| Logan, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Davis, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| CASlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| New Brunswick, US | 1 |
| Rovaniemi, FI | 1 |
| Riverside, US | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Millersville, US | 1 |
| Parkville, AU | 1 |
| Zapopan, MX | 1 |
| Baltimore, US | 1 |
| Hudson, US | 1 |
| Agriculture and Agri-Food Canadalocation not on record | 1 |
| Pocatello, US | 1 |
| Chicago, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Madrid, ES | 1 |
| Adelaide, AU | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Bourges, FR | 1 |
| Santa Barbara, US | 1 |
| Göteborg, SE | 1 |
| Cambridge, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Angwin, US | 1 |
| Dover, US | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Orem, US | 1 |
| ESP004location not on record | 1 |
| Salvador, BR | 1 |
| H-Dunkellocation not on record | 1 |
| 1 | |
| US | 1 |
| Portland, US | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Knoxville, US | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Namur, BE | 1 |
| Montréal, CA | 1 |
| nbflocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Oswego, US | 1 |
| US | 1 |
| San Diego, US | 1 |
| Irvine, US | 1 |
| Metsähallituslocation not on record | 1 |
| Odawara, JP | 1 |
| Corrientes, AR | 1 |
| BG-NMNHSlocation not on record | 1 |
| Austin, US | 1 |
| Clemson, US | 1 |
| IDElocation not on record | 1 |
| Albuquerque, US | 1 |
| Brisbane, AU | 1 |
| Fairfax, US | 1 |
266 institutions · 10 038 of 10 851 vouchered records shown · 725 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Atriplex patula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map6 countries0
Disturbed agricultural area
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 8.60–18.2
Seasonal swing summer↔winter15.3 °C
Max temp (day)18.5 °C 13.3–22.1
Min temp (night)11.0 °C 5.60–15.1
Precipitation78.8 mm/mo 53.8–94.8
Air humidity61.2 % 57.2–64.7
Moisture balance-13.7 mm/mo -46.9–26.0
Vapour deficit683 Pa 437–841
Wind speed3.70 m/s 2.50–4.90
Cloud cover45.0 % 38.9–53.1
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.