Atriplex paludosa

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records668

Data sources6

Biological traits29

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Atriplex paludosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility668 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF668 records

DNA & barcodingNCBIsequences

01Narrative

Atriplex paludosa subsp. baudinii is subspecies of Atriplex paludosa (marsh saltbush) that is endemic to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology11

Fruit length9.5 mm

Fruit width9.5 mm

Leaf length40 mm

Leaf size471 mm²

Leaf width8 mm

Petiole length0.3 cm

Plant height1 m

Plant height max1.6 m

Plant height min0.4 m

Seed length8 mm

Seed width5 mm

Life cycle & reproduction6

Dispersal typeself+wind

⚠ sources differ — AusTraits: anemochory barochory · GIFT: hydrochorous

Flowering timennnnyyyyynnn

Life formshrub

Life spanperennial

Pollination syndromewind

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical orbicular

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex paludosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOM180272.1 ↗590 bp

ACGT

CGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTTGGGGCGAAAGCCCCTCCCTCGAGCGGGGGAATCGCTAC …

Atriplex paludosa voucher chen 3284 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type668 records

Wild obs. + sensor555

Museum / vouchered111

Other2

Origin

Native404

Range

Area of Occupancy AOO1 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 317≤1 km 177≤10 km 14>10 km 6

514 georeferenced · 41 without coordinates

Open the mapobservation + sensor555

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 20≤1 km 19≤10 km 54>10 km 3

96 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	29
Kensington, AU	17
Canberra, AU	15
Museo Entomologico de Leonlocation not on record	9
Adelaide, AU	9
Brisbane, AU	7
Hobart, AU	4
Palmerston, AU	4
Claremont, US	3
Beijing, CN	2
Armidale, AU	2
BGPAlocation not on record	2
Parkville, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Auckland, NZ	1
La Trobe Universitylocation not on record	1
QVMAGlocation not on record	1

17 institutions · 108 of 111 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)