Atriplex longipes

Drejer & Fr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records3 937

Data sources11

Biological traits18

DNA specimens33

eDNA detections17

Sources11 archives

Databases and archives Atriplex longipes's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 937 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF3 937 records

Environmental DNA1 datasets · 3 countries17 detections

DNA & barcodingBOLD · NCBI33 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 18

01Narrative

Atriplex longipes is a species of plant belonging to the family Amaranthaceae. Its native range is northwestern and northern Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology4

Plant height0.262 m

⚠ sources differ — GIFT: 0.262 m · LEDA: 0.263 m · TRY: 0.412 m

Plant height max0.4 m

Plant height min0.1 m

Seed length2.4 mm

Life cycle & reproduction7

Deciduousnessevergreen

Dehiscenceindehiscent

Flowering endSep

Flowering startJul

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Carnivorynon-carnivorous

Habitat & environment4

Climatetemperate

Fruit typeachene

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex longipes has left across the world's sequence archives.

At a glance

DNA specimens33

Marker genes5

GenBank sequences10

eDNA detections17

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKX165935.1 ↗409 bpUnited Kingdom · 1994

ACGT

GAAGCCATTAGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCTCCCCCCAACCACCCCGCGTGGATTGGGAGGAGGATGATGG …

Atriplex longipes voucher NMW7373 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Atriplex longipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 189×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · CCDB · brit-fl +4

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Tree of Sex Database — ↗

CCDB · brit-fl — Jones, E.M. Watsonia 10: 233-251 (1975)

CCDB · brit-fl — Taschereau, P.M. (1979)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1828

CCDB · ipcn-api-dl — Taschereau, P. M. 1985. Taxonomy of Atriplex species indigenous to the British Isles. Watsonia 15: 183–209.

CCDB · ipcn-api-dl — Hulme. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index.Cambridge Univ. Press. P. 19.

CCDB · book-ipcn73-74 — GUSTAFSSON, M. 1973. Evolutionary trends in the Atriplex triangularis group of scandinavia. I. Hybrid sterility and chromosomal differentiation. Bot. Notiser 126: 345-392.

TreeOfSex · plant — Goldblatt1979 ↗

n 91×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — GUSTAFSSON, M. 1973. Evolutionary trends in the Atriplex triangularis group of scandinavia. I. Hybrid sterility and chromosomal differentiation. Bot. Notiser 126: 345-392.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 937 records

Wild obs. + sensor2 903

Museum / vouchered1 027

Cultivated / captive7

Origin

Native211

Introduced1

Range

Area of Occupancy AOO7 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 1 283≤1 km 509≤10 km 946>10 km 10

2 748 georeferenced · 155 without coordinates

Open the mapobservation + sensor2 903

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 442≤1 km 96≤10 km 127>10 km 39

704 georeferenced · 323 without coordinates

Open the institutions mapphysical evidence1 027

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DBF-NHMDlocation not on record	296
LDlocation not on record	165
SLU Artdatabankenlocation not on record	108
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	60
Tartu, EE	48
Helsinki, FI	34
Oskarshamn, SE	32
Garðabær, IS	31
Trondheim, NO	30
Olocation not on record	28
Oulu, FI	26
TROMlocation not on record	22
MeiseBGlocation not on record	18
Vancouver, CA	12
Tromso University Museumlocation not on record	11
Bergen, NO	11
Uppsala, SE	11
Philadelphia, US	10
Jyväskylä, FI	7
WTUlocation not on record	6
National Museum Waleslocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	4
NMBU:MINAlocation not on record	4
Provo, US	4
Kuopio, FI	3
TUR-Alocation not on record	3
Uniwersytet Jagiellońskilocation not on record	3
Wlocation not on record	2
	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Tallinn, EE	2
Xiamen, CN	2
Metsähallituslocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Corvallis, US	1
Pullman, US	1
University of Stellenboschlocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Bern, CH	1
Frankfurt am Main	1
B.A. Bennett Herbariumlocation not on record	1
Brussel, BE	1
MAlocation not on record	1
Turku, FI	1
Stockholm, SE	1
Salamanca, ES	1
Taipei, TW	1
CASlocation not on record	1
Berlin, DE	1

49 institutions · 1 021 of 1 027 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Atriplex longipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

Base of riprap at driftwood shore of mudflat…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 7.10–14.2

Seasonal swing summer↔winter14.5 °C

Max temp (day)14.2 °C 8.40–16.5

Min temp (night)8.80 °C 4.80–11.4

Precipitation120 mm/mo 78.0–172

Air humidity63.7 % 62.1–67.2

Moisture balance60.0 mm/mo

Vapour deficit484 Pa 345–592

Wind speed4.60 m/s

Cloud cover63.6 % 49.1–67.9

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atriplex longipes

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction7

Diet & foraging1

Habitat & environment4

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 937 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 937 records