Atriplex lindleyi

Moq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records4 367

Data sources10

Biological traits49

DNA specimens5

eDNA detections4

Sources10 archives

Databases and archives Atriplex lindleyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 367 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources49 traits

Occurrence & distributionGBIF4 367 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Atriplex lindleyi is a species of saltbush known by the common name Lindley's saltbush. It is native to Australia, where it is widespread, especially in dry areas. It is known elsewhere as an introduced species, in California and the United States an invasive species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Leaf length20 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf mass3 mg

Leaf mass per area127 g/m2

Leaf size20.4 mm²

Leaf width5.75 mm

Leaf width max15 mm

Leaf width min3 mm

Plant height0.2 m

⚠ sources differ — GIFT: 0.2 m · AusTraits: 0.35 m · TRY: 0.15 m

Plant height max4 m

Plant height min0.12 m

Seed mass0.953 mg

⚠ sources differ — TRY: 0.953 mg · AusTraits: 2.75 mg · GIFT: 2.6 mg

Seed mass max5.63 mg

Seed mass min0.953 mg

Seed volume0.9 mm³

Seed volume max0.9 mm³

Seed volume min0.9 mm³

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typewind

Flowering endJun

Flowering startMay

Flowering timeyyyyyyyyyyyy

Life formannual or perennial

Life spanannual

⚠ sources differ — TRY: annual · AusTraits: annual short_lived_perennial · GIFT: annual

Pollination syndromewind

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 350 m

Elevation min1 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf formelliptic

Leaf shapeobovate orbicular rhomboidal

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Specific leaf area (SLA)7.93 mm²/mg

Other traits3

Inflorescencespike

Leaf arrangementalternate

Shoot orientationascending

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex lindleyi has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences8

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOM180177.1 ↗590 bp

ACGT

CGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTAGGGGTGAAAGCCCCTTCCTCAAGCGGGGGAATCGCTAC …

Atriplex lindleyi subsp. conduplicata voucher chen 442 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Atriplex lindleyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BASSETT, I.J., & c.w. CROMPTON. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442.

n 94×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1

CCDB · ipcn-api-dl — NOBS, M. A. 1978. Chromosomal numbers in Atriplex. Carnegie Inst. Wash. Year Book 77: 240–241.

CCDB · book-ipcn67-71 — TANDON, S.L., & M. TAWAKLEY. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269.

CCDB · book-ipcn75-78 — Nobs 1978

CCDB · book-ipcn73-74 — TAWAKLEY, M., & S.L. TANDON. 1974. Cytotaxonomic studies of some Atriplex species. Acta Bot. Indica 2: 17-22.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 367 records

Wild obs. + sensor3 771

Museum / vouchered585

Cultivated / captive5

Other6

Origin

Native1 282

Introduced51

Range

Area of Occupancy AOO8 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 277≤1 km 236≤10 km 101>10 km 27

3 641 georeferenced · 130 without coordinates

Open the mapobservation + sensor3 771

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 114≤1 km 187≤10 km 141>10 km 27

469 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence585

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	151
Adelaide, AU	120
Brisbane, AU	42
San Diego, US	31
Canberra, AU	24
Museo Entomologico de Leonlocation not on record	23
Cape Town, ZA	20
John T. Waterhouse Herbariumlocation not on record	15
Armidale, AU	12
Riverside, US	12
Claremont, US	12
Kensington, AU	9
NSW Dept of Planning, Industry and Environmentlocation not on record	9
Santa Barbara, US	8
Bronx, US	6
Phoenix, US	5
Canadian Department of Agriculturelocation not on record	5
Stockholm, SE	4
Palmerston, AU	4
Hobart, AU	4
CASlocation not on record	3
Irvine, US	3
Mexico City, MX	2
Kew, GB	2
Severin-McDaniel Insect Collectionlocation not on record	2
Moscow State Universitylocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
MAlocation not on record	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
San Luis Obispo, US	1
MeiseBGlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
Arizona State University Biocollectionslocation not on record	1
Austin, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
ASUlocation not on record	1
Austin, US	1
James Cook Townsvillelocation not on record	1

39 institutions · 542 of 585 vouchered records shown · 43 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Atriplex lindleyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 14.6–14.6

Seasonal swing summer↔winter7.40 °C

Max temp (day)18.0 °C

Min temp (night)11.0 °C

Precipitation49.4 mm/mo

Air humidity60.5 %

Moisture balance-42.9 mm/mo

Vapour deficit653 Pa

Wind speed1.20 m/s

Cloud cover30.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atriplex lindleyi

At a glance

Sources10 archives

Size & morphology18

Life cycle & reproduction11

Diet & foraging1

Habitat & environment13

Physiology & chemistry3

Other traits3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 367 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 39 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 367 records