Atriplex leptocarpa

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records4 430

Data sources7

Biological traits33

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Atriplex leptocarpa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 430 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF4 430 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Atriplex leptocarpa là loài thực vật có hoa thuộc họ Dền. Loài này được F.Muell. mô tả khoa học đầu tiên năm 1858.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Leaf length30 mm

Leaf length max30 mm

Leaf mass16 mg

Leaf mass per area84.07 g/m2

Leaf size167 mm²

Leaf width5.7 mm

Plant height0.25 m

⚠ sources differ — AusTraits: 0.25 m · TRY: 0.21 m

Seed length5.48 mm

Seed mass0.791 mg

⚠ sources differ — TRY: 0.791 mg · AusTraits: 1.94 mg

Seed width1.58 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timeyyyyyyyyyyyy

Life formannual or perennial

Life spanbiennial/shortlived perennial

⚠ sources differ — TRY: biennial/shortlived perennial · AusTraits: annual short_lived_perennial · GIFT: perennial

Pollination syndromewind

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: shrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical narrowly_oblanceolate rhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Specific leaf area (SLA)18.78 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex leptocarpa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM180234.1 ↗571 bp

ACGT

AGCGACCAGAGAACGTGTTTATCATGAACGGGGTAGGGGTGAAAGCCCCTTCCTCTAGCGGGGGAGCGCTACGCCTTGGCGGGGCGTCCT …

Atriplex leptocarpa voucher chen 439 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type4 430 records

Wild obs. + sensor3 736

Museum / vouchered686

Cultivated / captive4

Other4

Origin

Native437

Introduced15

Range

Area of Occupancy AOO9 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 3 380≤1 km 231≤10 km 103>10 km 7

3 721 georeferenced · 15 without coordinates

Open the mapobservation + sensor3 736

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 122≤1 km 217≤10 km 234>10 km 66

639 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence686

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	187
Mount Annan, AU	154
Museo Entomologico de Leonlocation not on record	112
Canberra, AU	93
Brisbane, AU	44
John T. Waterhouse Herbariumlocation not on record	9
Armidale, AU	9
Palmerston, AU	7
Kensington, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
MeiseBGlocation not on record	4
LDlocation not on record	4
Kew, GB	3
Bronx, US	2
Stockholm, SE	2
NSW Office of Environment and Heritagelocation not on record	2
Hobart, AU	2
Bern, CH	1
Christchurch, NZ	1

19 institutions · 645 of 686 vouchered records shown · 41 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Atriplex leptocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atriplex leptocarpa

At a glance

Sources7 archives

Size & morphology10

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type4 430 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 430 records