Atriplex laciniata

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records11 359

Data sources11

Biological traits35

DNA specimens26

eDNA detections11

Sources11 archives

Databases and archives Atriplex laciniata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 359 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF11 359 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex841 Mbp

01Narrative

L'Arroche laciniée ou Arroche des sables est une espèce de plantes de la famille des Amaranthacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology10

Leaf mass118 mg

Leaf size316 mm²

⚠ sources differ — TRY: 316 mm² · LEDA: 1 803 mm² · GIFT: 1 803 mm²

Plant height0.568 m

⚠ sources differ — GIFT: 0.568 m · LEDA: 0.425 m · TRY: 0.425 m

Plant height generative1.04 m

Plant height max0.6 m

Plant height min0.2 m

Seed length3.4 mm

Seed mass21.43 mg

Seed mass max21.44 mg

Seed mass min21.44 mg

Life cycle & reproduction12

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dehiscenceindehiscent

Dispersal typewater

Flowering endSep

Flowering startJul

Life formannual

Life spanannual

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Seed number22 500

Self fertilizationpresent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)211 mg/g

Photosynthetic pathwayC4

Specific leaf area (SLA)16.45 mm²/mg

Other traits1

Diaspore typeone-seeded generative dispersule

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex laciniata has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes7

GenBank sequences10

eDNA detections11

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMG237417.1 ↗311 bpCanada · 1963

ACGT

CCCGAAGCCATTAGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCTCCCCCCACCACCTCGTGTGGAAGGGTTGGAGGATGAT …

Atriplex laciniata voucher CCDB-23309-G11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS6★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Atriplex laciniata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size841 080 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atriplex laciniata0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 189×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · CCDB · brit-fl +6

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Tree of Sex Database — ↗

CCDB · brit-fl — Taschereau, P.M. Watsonia 15: 183-209 (1985)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1833

CCDB · ipcn-api-dl — Taschereau, P. M. 1985. Taxonomy of Atriplex species indigenous to the British Isles. Watsonia 15: 183–209.

CCDB · book-ipcn67-71 — BASSETT, I.J., & c.w. CROMPTON. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442.

CCDB · eflora

CCDB · book-fedorov — Wulff 1936, 1937a

TreeOfSex · plant — Goldblatt1979 ↗

n 93×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · TreeOfSex · plant

CCDB · ipcn-api-dl — NOBS, M. A. 1975. Chromosome numbers in Atriplex. Carnegie Inst. Wash. Year Book 74: 762–765.

CCDB · book-ipcn75-78 — Nobs 1975

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type11 359 records

Wild obs. + sensor10 848

Museum / vouchered508

Cultivated / captive3

Origin

Native2 478

Introduced1

Range

Area of Occupancy AOO11 752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 4 077≤1 km 1 590≤10 km 4 748>10 km 7

10 422 georeferenced · 426 without coordinates

Open the mapobservation + sensor10 848

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 71≤1 km 123≤10 km 55>10 km 27

276 georeferenced · 232 without coordinates

Open the institutions mapphysical evidence508

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	77
LDlocation not on record	58
MeiseBGlocation not on record	37
South Kensington, GB	27
KMNlocation not on record	19
Bergen, NO	16
DBF-NHMDlocation not on record	13
SLU Artdatabankenlocation not on record	12
Oskarshamn, SE	11
BSBIlocation not on record	10
Trondheim, NO	9
Uppsala, SE	8
Saint John, CA	7
MAlocation not on record	5
Acadia Universitylocation not on record	5
Uniwersytet Śląski w Katowicachlocation not on record	4
Montréal, CA	4
BRNUlocation not on record	4
Claremont, US	4
BClocation not on record	3
National Museum Waleslocation not on record	3
Berlin, DE	3
Brussel, BE	3
Sion, CH	2
NMBU:MINAlocation not on record	2
BFLlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Chongqing Museumlocation not on record	2
Pullman, US	2
Podgorica, ME	2
Moscow State Universitylocation not on record	2
Bourges, FR	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Mlocation not on record	1
Philadelphia, US	1
John May Museum of Natural Historylocation not on record	1
Royal Botanic Garden Edinburghlocation not on record	1
Paris, FR	1
Université Lavallocation not on record	1
ASUlocation not on record	1
Tilburg, NL	1
College of the Atlantic, Museumlocation not on record	1
Bronx, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
CICYTEXlocation not on record	1
Bozeman, US	1
Kew, GB	1
Bloomington, US	1
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	1

49 institutions · 378 of 508 vouchered records shown · 130 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Atriplex laciniata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

beach and sand dune communitiesbeach sandon sandsandy beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 12.9–18.5

Seasonal swing summer↔winter13.2 °C

Max temp (day)17.3 °C 14.9–22.1

Min temp (night)12.2 °C 10.1–15.9

Precipitation83.5 mm/mo 46.1–108

Air humidity62.3 % 56.0–66.6

Moisture balance-4.80 mm/mo

Vapour deficit666 Pa 501–935

Wind speed4.60 m/s

Cloud cover49.4 % 33.9–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atriplex laciniata

At a glance

Sources11 archives

Size & morphology10

Life cycle & reproduction12

Diet & foraging2

Habitat & environment7

Physiology & chemistry3

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type11 359 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 359 records