Atriplex kochiana

Maiden · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records111

Data sources4

Biological traits18

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Atriplex kochiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility111 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF111 records

DNA & barcodingNCBIsequences

01Narrative

Atriplex kochiana là loài thực vật có hoa thuộc họ Dền. Loài này được Maiden mô tả khoa học đầu tiên năm 1897.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length25 mm

Plant height0.4 m

Seed mass4.67 mg

⚠ sources differ — TRY: 4.67 mg · AusTraits: 5.17 mg · GIFT: 4.54 mg

Seed mass max4.54 mg

Seed mass min4.54 mg

Life cycle & reproduction5

Dispersal typeself+wind

Life formannual or perennial

Life spanannual short_lived_perennial

Pollination syndromewind

Sex typemonoecious

Habitat & environment7

Climatedesert or dry shrubland

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — AusTraits: herb · TRY: herb/shrub

Leaf compoundnesssimple

Leaf shaperhomboidal widely_obovate

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous

Physiology & chemistry1

Photosynthetic pathwayC4

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex kochiana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOM180226.1 ↗590 bp

ACGT

CGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTAGGGGTGAAAGCCCCTTCCTCGAGCGGGGGAATCGCTCC …

Atriplex kochiana voucher chen 3322 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type111 records

Wild obs. + sensor57

Museum / vouchered54

Origin

Native58

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 55

55 georeferenced · 2 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 3≤1 km 23≤10 km 20>10 km 3

49 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	31
Museo Entomologico de Leonlocation not on record	9
Kensington, AU	6
Mount Annan, AU	3
Brisbane, AU	2
Canberra, AU	2
MAlocation not on record	1

7 institutions · 54 of 54 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)