Atriplex fissivalvis

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records409

Data sources5

Biological traits26

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Atriplex fissivalvis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility409 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF409 records

DNA & barcodingNCBIsequences

01Narrative

Atriplex fissivalvis, commonly known as gibber saltbush, is a plant species in the family Amaranthaceae, subfamily, Chenopodioideae. It occurs in the Australian states of South Australia, New South Wales, Queensland and the Northern Territory.AVH Occurrence data: Atriplex fissivalvis

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology7

Leaf length17 mm

Leaf length max20 mm

Leaf width9 mm

Petiole length0.75 cm

Plant height0.3 m

⚠ sources differ — GIFT: 0.3 m · AusTraits: 0.25 m

Plant height max0.3 m

Seed mass0.509 mg

Life cycle & reproduction6

Dispersal typeself+wind

Life formannual

Life spanannual

Pollination syndromewind

Raunkiær life formtherophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf shapeorbicular ovate

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex fissivalvis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM180200.1 ↗590 bp

ACGT

CGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTAGGGGTGAAAGCCCCTTCCTCGAGCGGGGGAATCGCTAC …

Atriplex fissivalvis voucher chen 905 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type409 records

Wild obs. + sensor161

Museum / vouchered247

Other1

Origin

Native175

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 93≤1 km 41≤10 km 8>10 km 2

144 georeferenced · 17 without coordinates

Open the mapobservation + sensor161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 52≤1 km 94≤10 km 78>10 km 15

239 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	122
Canberra, AU	22
Mount Annan, AU	21
Brisbane, AU	19
Palmerston, AU	19
Museo Entomologico de Leonlocation not on record	8
John T. Waterhouse Herbariumlocation not on record	5
Hobart, AU	2
Kensington, AU	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
MAlocation not on record	1
Kew, GB	1
Armidale, AU	1
Guangzhou, CN	1
MeiseBGlocation not on record	1

15 institutions · 226 of 247 vouchered records shown · 21 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)