Atriplex cinerea

Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records3 810

Data sources11

Biological traits37

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Atriplex cinerea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 810 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF3 810 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · TreeOfSex2n = 54

01Narrative

Atriplex cinerea, commonly known as grey saltbush, coast saltbush, barilla or truganini, is a plant species in the family Amaranthaceae. It occurs in sheltered coastal areas and around salt lakes in the Australian states of Western Australia, South Australia, Tasmania, Victoria and New South Wales. The Latin specific name cinerea means "ashy". Atriplex cinerea has a chromosome number 2n=54, indicating the species is hexaploid as the base number in Atriplex is 9.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Leaf length40 mm

Leaf length max100 mm

Leaf size1 571 mm²

Leaf width12 mm

Plant height1.5 m

⚠ sources differ — AusTraits: 1.5 m · TRY: 0.4 m

Plant height max5 m

Plant height min0.2 m

Seed length7 mm

Seed mass7.02 mg

⚠ sources differ — TRY: 7.02 mg · AusTraits: 9.16 mg · GIFT: 7.73 mg

Seed mass max9.15 mg

Seed mass min6.31 mg

Seed width2 mm

Life cycle & reproduction9

Deciduousnessdeciduous

Dispersal typewind

Flowering timeyyyyyyyyyyyy

Life formshrub

Life spanperennial

Lifespan years1 years

Pollination syndromewind

Resprouting capacityfire_killed

Sex typedioecious+monoecious

⚠ sources differ — AusTraits: dioecious monoecious · GIFT: dioecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min600 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_elliptical ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayCAM

⚠ sources differ — TRY: CAM · AusTraits: c4 · GIFT: C4

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex cinerea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOM180173.1 ↗590 bp

ACGT

CGAAACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTCGGGGCGAAAGCCCCTTCCTCAGCCGGAGAATCGCTTCG …

Atriplex cinerea voucher chen 435 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Atriplex cinerea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 541×CCDB · new-zealand

CCDB · new-zealand

n 271×TreeOfSex · plant

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 810 records

Wild obs. + sensor2 605

Museum / vouchered1 200

Cultivated / captive1

Other4

Origin

Native525

Introduced3

Range

Area of Occupancy AOO6 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 322≤1 km 671≤10 km 227>10 km 46

2 266 georeferenced · 339 without coordinates

Open the mapobservation + sensor2 605

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 91≤1 km 382≤10 km 564>10 km 41

1 078 georeferenced · 122 without coordinates

Open the institutions mapphysical evidence1 200

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	330
Museo Entomologico de Leonlocation not on record	193
Hobart, AU	173
Canberra, AU	135
Mount Annan, AU	123
Kensington, AU	112
Brisbane, AU	18
Pretoria, ZA	17
QVMAGlocation not on record	14
Cape Town, ZA	8
Batemans Bay, AU	6
Wellington, NZ	6
Kew, GB	4
Christchurch, NZ	4
Palmerston, AU	4
BGPAlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	2
LDlocation not on record	2
Armidale, AU	2
MAlocation not on record	2
CASlocation not on record	2
Parkville, AU	2
Wollongong, AU	2
Smithfield, AU	2
MeiseBGlocation not on record	2
Provo, US	1
University of Johannesburglocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
AUAlocation not on record	1

29 institutions · 1 172 of 1 200 vouchered records shown · 28 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Atriplex cinerea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 14.6–14.6

Seasonal swing summer↔winter5.90 °C

Max temp (day)19.1 °C

Min temp (night)11.0 °C

Precipitation13.4 mm/mo

Air humidity58.7 %

Moisture balance-96.1 mm/mo

Vapour deficit685 Pa

Wind speed4.00 m/s

Cloud cover8.20 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atriplex cinerea

At a glance

Sources11 archives

Size & morphology12

Life cycle & reproduction9

Diet & foraging1

Habitat & environment12

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 810 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 810 records