Atriplex canescens
(Pursh) Nutt. · speciesAt a glance
Occurrence records13 952
Data sources12
Biological traits105
DNA specimens29
eDNA detections15
Sources12 archives
Databases and archives Atriplex canescens's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 952 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics29 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources105 traits
Occurrence & distributionGBIF13 952 records
Environmental DNA1 datasets · 6 countries15 detections
DNA & barcodingBOLD · NCBI29 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 18
01Narrative
Atriplex nuttallii, also known as Nuttall's saltbush, is native to central and western North America. It has been treated by some botanists as a synonym of Atriplex canescens.Jepson eFlora: Atriplex canescens . accessed 14 February 2016.Calflora: Atriplex canescens . accessed 14 February 2016.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology6
Plant height1.2 m
⚠ sources differ — GIFT: 1.2 m · AusTraits: 0.8 m · USDA: 2.13 m · TRY: 1.18 m
Plant height max0.8 m
Seed length6.17 mm
Seed mass8.95 mg
⚠ sources differ — TRY: 8.95 mg · GIFT: 7.64 mg
Seed mass max19.72 mg
Seed mass min0.9 mg
Life cycle & reproduction25
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typewind
Flower colouryellow
Flower conspicuousNo
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDASlow
Life formshrub
Life spanperennial
Lifespan categoryLong
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityYes
Seed spread rateSlow
Seedling vigorHigh
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatLow
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typenut
Growth formshrub
Growth form USDAMultiple Stem
Hedge toleranceHigh
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min20 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min152 days
Leaf n21 mg/g
Leaf p1.98 mg/g
Moisture useLow
Nitrogen fixation levelNone
Photosynthetic pathwayC4
⚠ sources differ — TRY: C4 · GIFT: C3
Precipitation max18 in
Precipitation min6.5 in
Protein potentialMedium
Salinity toleranceHigh
Shade toleranceHigh
Soil pH max9 pH
Soil pH min6.55 pH
Specific leaf area (SLA)3.97 mm²/mg
Temperature min-25.5 °F
Wood density852 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound52 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr1.68 m
Planting density max2 200 per acre
Planting density min470 per acre
05DNA & barcoding29 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex canescens has left across the world's sequence archives.
At a glance
DNA specimens29
Marker genes5
GenBank sequences10
eDNA detections15
Countries6
The DNA barcodea real sequence read deposited for this species
CCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTCTGGGCGAAAGCCCATTCCTCAAGCTAGGGAATCGCTGCACCTCGGTG …
Atriplex canescens voucher NP1.7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcLa★ITS10★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Atriplex canescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–362n range18median18mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1810×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.
CCDB · ipcn-api-dl — CROMPTON, C. W. & I. J. BASSETT. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Sankary, M. N. 1986. Chromosome Number Reports 91. Taxon 35:404.
CCDB · ipcn-api-dl — Ruas, C. F., P. M. Ruas, H. C. Stutz & D. J. Fairbanks. 2001. Cytogenetic studies in the genus Atriplex (Chenopodiaceae). Caryologia 54: 129–145.
CCDB · book-ipcn75-78 — NA
CCDB · book-ipcn75-78 — Crompton & Bassett 1975
CCDB · eflora
TreeOfSex · plant — Goldblatt1979 ↗
2n 363×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora
CCDB · ipcn-api-dl — CROMPTON, C. W. & I. J. BASSETT. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · book-ipcn67-71 — BASSETT, I.J., & C.W. CROMPTON. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797"":"
CCDB · eflora
2n 451×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — STUTZ, H. C., C. L. Pope & S. C. Sanderson. 1979. Evolutionary studies of Atriplex: Adaptive products from the natural hybrid, 6N A. tridentata x 4N A. canescens. Amer. J. Bot. 66: 1181–1193.
n 183×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · TreeOfSex · plant
CCDB · ipcn-api-dl — POPE, C. L. & E. D. McArthur. 1977. In IOPB chromosome number reports LV. Taxon 26: 107–109.
CCDB · book-ipcn75-78 — Pope & McArthur 1977
TreeOfSex · plant — Goldblatt1979 ↗
n 92×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Sanderson, S. C. & H. C. Stutz. 1994. High chromosome numbers in Mojavean and Sonoran desert Atriplex canescens (Chenopodiaceae). Amer. J. Bot. 81(8): 1045–1053.
CCDB · book-ipcn75-78 — NA
n 541×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sanderson, S. C. & H. C. Stutz. 1994. High chromosome numbers in Mojavean and Sonoran desert Atriplex canescens (Chenopodiaceae). Amer. J. Bot. 81(8): 1045–1053.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type13 952 records
Wild obs. + sensor10 114
Museum / vouchered3 821
Cultivated / captive14
Other3
Origin
Native214
Range
Area of Occupancy AOO27 104 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 6 461≤1 km 726≤10 km 322>10 km 388
7 897 georeferenced · 2 217 without coordinates
Open the mapobservation + sensor10 114
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 407≤1 km 591≤10 km 766>10 km 182
1 946 georeferenced · 1 875 without coordinates
Open the institutions mapphysical evidence3 821
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 14 records without
Open the mapnot free-living14
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions103 of 147 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 349 |
| ASUlocation not on record | 269 |
| Claremont, US | 249 |
| Albuquerque, US | 218 |
| Riverside, US | 179 |
| Phoenix, US | 160 |
| Flagstaff, US | 146 |
| Austin, US | 142 |
| San Diego, US | 139 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 117 |
| Wuzhou, CN | 114 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 90 |
| EL PASO, US | 84 |
| Mexico City, MX | 84 |
| Denver, US | 74 |
| University of Stellenboschlocation not on record | 64 |
| Lubbock, US | 61 |
| Chadron, US | 53 |
| Fort Worth, US | 46 |
| Provo, US | 39 |
| Santa Barbara, US | 39 |
| Boise, US | 38 |
| San Luis Obispo, US | 37 |
| Durango, MX | 35 |
| Mexico City, MX | 33 |
| Chongqing Museumlocation not on record | 33 |
| Spearfish, US | 32 |
| Pullman, US | 30 |
| Pocatello, US | 27 |
| San Angelo, US | 27 |
| Davis, US | 26 |
| Logan, US | 25 |
| Moscow, US | 25 |
| Durango, US | 25 |
| Caldwell, US | 24 |
| Tempe, US | 21 |
| Missoula, US | 21 |
| Tampa, US | 20 |
| Canadian Department of Agriculturelocation not on record | 19 |
| Saint Louis, US | 19 |
| Henderson, US | 18 |
| Austin, US | 16 |
| Guasave, MX | 16 |
| US | 16 |
| Torreón, MX | 14 |
| Hermosillo, MX | 14 |
| US | 13 |
| Museo Entomologico de Leonlocation not on record | 13 |
| Irvine, US | 12 |
| Montecillo, Texcoco, MX | 11 |
| CASlocation not on record | 10 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 10 |
| Bloomington, US | 10 |
| Zacatecas, MX | 9 |
| DOI/NPS, Greenbelt Parklocation not on record | 9 |
| Long Beach, US | 9 |
| Tlalnepantla, MX | 8 |
| Ensenada, MX | 8 |
| Chapingo, MX | 8 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 8 |
| La Paz, MX | 7 |
| Burlington, US | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Grand Junction, US | 7 |
| USFSlocation not on record | 6 |
| Emporia, US | 6 |
| WTUlocation not on record | 6 |
| San Luis Potosí, MX | 6 |
| Eastern Nevada Landscape Coalitionlocation not on record | 6 |
| US | 6 |
| Bangkok, TH | 6 |
| Canberra, AU | 6 |
| Bureau of Land Managementlocation not on record | 5 |
| Weber State Universitylocation not on record | 5 |
| Arcata, US | 5 |
| Lincoln, US | 5 |
| Mexico City, MX | 5 |
| Acadia Universitylocation not on record | 5 |
| Severin-McDaniel Insect Collectionlocation not on record | 5 |
| Angwin, US | 5 |
| Arizona Western Collegelocation not on record | 5 |
| Giardini Botanici Hanburylocation not on record | 5 |
| Mount Annan, AU | 4 |
| Columbia, US | 4 |
| Mississippi State, US | 4 |
| Los Angeles, US | 4 |
| Corvallis, US | 4 |
| Calabar, NG | 4 |
| Arizona State University Biocollectionslocation not on record | 4 |
| Philadelphia, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Zapopan, MX | 3 |
| VALElocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Madison, US | 3 |
| Brookings, US | 3 |
| Northridge, US | 2 |
| MAlocation not on record | 2 |
| Hobart, AU | 2 |
| Moscow State Universitylocation not on record | 2 |
| Portland, US | 2 |
| Auckland, NZ | 2 |
| Culiacán, MX | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| GB | 2 |
| Macomb, US | 2 |
| Orem, US | 2 |
| Kensington, AU | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Kunming, CN | 1 |
| Millersville, US | 1 |
| San Jose, US | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Wellington, NZ | 1 |
| Paris, FR | 1 |
| Chapel Hill, US | 1 |
| Xiamen, CN | 1 |
| Chicago, US | 1 |
| Kew, GB | 1 |
| College Park, US | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Tacoma, US | 1 |
| Vancouver, CA | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Fayetteville, US | 1 |
| University of Johannesburglocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Morelia, MX | 1 |
| Wlocation not on record | 1 |
| PRClocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Miami, US | 1 |
| PHlocation not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Santa Cruz, US | 1 |
| Mérida, MX | 1 |
| Clemson, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| BISHlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| South Kensington, GB | 1 |
| Bozeman, US | 1 |
| Ciudad de México, MX | 1 |
| Honolulu, US | 1 |
147 institutions · 3 702 of 3 821 vouchered records shown · 118 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Atriplex canescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map6 countries0
Atriplex canescens., Sandy flat dry shelf ab…Sand dunes with Prosopis glandulosa leading …Desert Wash Scrub with Psorothamnus spinosus…over soil
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.8 °C 3.10–24.7
Seasonal swing summer↔winter20.2 °C
Max temp (day)22.7 °C 9.40–32.4
Min temp (night)14.7 °C -3.40–17.9
Precipitation24.8 mm/mo 8.40–83.2
Air humidity52.8 % 43.0–60.4
Moisture balance-78.9 mm/mo
Vapour deficit1,012 Pa 359–1,734
Wind speed3.10 m/s
Cloud cover20.5 % 13.2–43.6
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.