Atriplex angulata

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Atriplex

At a glance

Occurrence records1 303

Data sources5

Biological traits33

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Atriplex angulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 303 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF1 303 records

DNA & barcodingNCBIsequences

01Narrative

Atriplex angulata là loài thực vật có hoa thuộc họ Dền. Loài này được Benth. mô tả khoa học đầu tiên năm 1870.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf length40 mm

Leaf length max40 mm

Leaf mass13 mg

Leaf mass per area94.28 g/m2

Leaf size62.5 mm²

⚠ sources differ — TRY: 62.5 mm² · AusTraits: 75.9 mm²

Leaf width17.5 mm

Plant height0.45 m

⚠ sources differ — AusTraits: 0.45 m · TRY: 0.675 m

Plant height max0.5 m

Seed mass1.48 mg

⚠ sources differ — TRY: 1.48 mg · AusTraits: 2.4 mg · GIFT: 2.28 mg

Seed mass max5.55 mg

Seed mass min0.607 mg

Life cycle & reproduction8

Dispersal typeself+wind

Flowering timennnynnnnnnnn

Life formannual or perennial

Life spanannual

⚠ sources differ — TRY: annual · AusTraits: annual short_lived_perennial · GIFT: annual

Pollination syndromewind

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf shaperhomboidal widely_obovate

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Specific leaf area (SLA)6.88 mm²/mg

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atriplex angulata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM180153.1 ↗586 bp

ACGT

ACCTGCCCAGCAGAGCGACCAGAGAACGTGTTTATCATGAACGGGGTAGGGGTGAAAGCCCCTTCCTCGAGCGGGGGAATCGCTACGCCT …

Atriplex angulata voucher chen 443 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type1 303 records

Wild obs. + sensor644

Museum / vouchered656

Other3

Origin

Native466

Range

Area of Occupancy AOO3 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 486≤1 km 77≤10 km 41>10 km 6

610 georeferenced · 34 without coordinates

Open the mapobservation + sensor644

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 134≤1 km 200≤10 km 222>10 km 72

628 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence656

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	307
Mount Annan, AU	75
Canberra, AU	72
Brisbane, AU	38
Palmerston, AU	28
Museo Entomologico de Leonlocation not on record	19
John T. Waterhouse Herbariumlocation not on record	11
Armidale, AU	8
NSW Dept of Planning, Industry and Environmentlocation not on record	7
Kensington, AU	4
LDlocation not on record	3
Hobart, AU	2
Kew, GB	2
IPA/SPlocation not on record	1
Parkville, AU	1
University of Stellenboschlocation not on record	1
Auckland, NZ	1

17 institutions · 580 of 656 vouchered records shown · 76 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atriplex angulata

At a glance

Sources5 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type1 303 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 17 geolocated

Record type1 303 records