Atrichum undulatum
(Hedw.) P.Beauv. · speciesAt a glance
Occurrence records114 151
Data sources9
Biological traits1
DNA specimens26
eDNA detections12
Sources9 archives
Databases and archives Atrichum undulatum's data was compiled from.
WikipediaWikimedia Foundation8 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility114 151 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources1 traits
Occurrence & distributionGBIF114 151 records
Environmental DNA1 datasets · 5 countries12 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB2.1 Gbp
01Narrative
Atrichum undulatum is a species of mosses belonging to the family Polytrichaceae. It is native to Eurasia and North America.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRY
Habitat & environment1
Growth formnonvascular
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrichum undulatum has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes7
GenBank sequences10
eDNA detections12
Countries5
The DNA barcodea real sequence read deposited for this species
ACCTCAAGATGAGTGCTCTCCTATTCTTACTTCCCTGTAAGCATTTGGTCGCAAACACGGCCAAAATAACGATAGATTCTCTGTTCTTAC …
Atrichum undulatum 23S ribosomal RNA gene, partial sequence; and internal transcribed spacer 2, 4.5S ribosomal RNA gene, internal transcribed spacer 3, 5S ribosomal RNA gene, and 5S-tRNA-Arg intergenic spacer, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL9★rbcLa★trnL★trnL-F★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Atrichum undulatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 063 579 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Atrichum undulatum2.06 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
n 2112×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +2
CCDB · ipcn-api-dl — Lobachevskaya, O. V. & S. V. Gapon. 1988. Chromosomal numbers of leafy mosses (Musci) of the Ukraine. Ukrajins'k. Bot. Žurn. 45: 49–52.
CCDB · ipcn-api-dl — Javorčíková, D. & V. Peciar. 1986. Karyological study of the bryoflora of Slovakia I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 31–36.
CCDB · ipcn-api-dl — Javorčíková, D., T. Ilovská & V. Peciar. 1988. Karyological study of the bryoflora of Slovakia II. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 36: 79–86.
CCDB · ipcn-api-dl — Uniyal, P. L. 2004. Studies on the west Himalayan Polytrichaceae (Musci). Cytologia 69(2): 221–224.
CCDB · book-ipcn72 — BACHURINA, A.F . & O.F. SOLONINA. 1972. Chromosome numbers in sixteen species of mosses in the Ukrainian SSR plain part. Ukrajinsk. Bot. Zurn. 29: 88-96
CCDB · book-ipcn72 — WIGH, K. 1972. Chromosome numbers in some mosses from Central and south Europe. Bryol. 75: 136-146.
CCDB · book-ipcn67-71 — VYSOTSKAYA, E.I., & L.N. FETISOVA. 1969. Chromosome numbers of mosses from the Latvian SSR. Citologija i Genetika 3: 469-471.
CCDB · book-ipcn67-71 — FETISOVA L.N . & E.J. VISOTZKAYA. 1970. Chromosome numbers in the mosses from Estonia. (in Russian) Bot. Zurn. (Moscow & Leningrad) 55: 1150-1152.
CCDB · book-ipcn67-71 — VYSOTSKA, O.I. 1970. Chromosome numbers of mosses from the Caucasus. Ukrajinsk Bot. Zurn. 27: 179-182.
CCDB · book-ipcn73-74 — BRYAN, V.S. 1973. Chromosome studies on mosses from Austria, Czechoslovakia and other parts of central Europe. Oesterr. Bot. z. 187-226. I
CCDB · book-ipcn73-74 — WIGH, K., £. S.O. STRANDHEDE. 1971. Chromosome numbers in some swedish and Danish mosses. Bot. Notiser 124: 213-227.
CCDB · Cave1957 — Lewis
n 78×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1956supp +1
CCDB · ipcn-api-dl — Kumar, S. S., S. Talwani & G. Bassi. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Yu, M., Y. l. Zhou & J. x. Luo. 1997. Cytological observation of 8 species of mosses. J. Beijing Normal Univ., Nat. Sci. 33(2): 261–262.
CCDB · ipcn-api-dl — Zhou, Y. l., L. x. Ma, Q. He, Y. j. Sun, H. f. Jiang, P. c. Wu, M. z. Wang & G. s. Du. 1997. Chromosome observation on Chinese bryophytes IV. Chenia 3–4: 47–50.
CCDB · book-ipcn67-71 — KHANNA, K. R. 1967. Cytological investigation of the mosses of the Rocky Mountains. Univ. Colo. studies Ser. Biol. No. 26: 1-39.
CCDB · book-ipcn67-71 — TATUNO, s., & Y. KISE. 1970. Cytological studies on Atrichum, with special reference to structural sex chromosomes and sexuality. Bot. Mag. (Tokyo) 83: 163-172.
CCDB · book-ipcn67-71 — ONO, K. 1970. Karyological studies on Mniaceae and Polytrichaceae, with special reference to the structural sex-chromosomes. III. J. Sci. Hiroshima Univ. Ser. B, Div. 2, 13: 167-221.
CCDB · Cave1956supp — Steere, And., Bry. 54
CCDB · Cave1962 — Bird 1962
n 142×CCDB · book-ipcn67-71 · CCDB · Cave1956supp
CCDB · book-ipcn67-71 — TATUNO, s., & Y. KISE. 1970. Cytological studies on Atrichum, with special reference to structural sex chromosomes and sexuality. Bot. Mag. (Tokyo) 83: 163-172.
CCDB · Cave1956supp — Lowry 1954b
08Occurrence & distribution
Record type114 151 records
Wild obs. + sensor98 401
Museum / vouchered15 596
Cultivated / captive5
Other149
Origin
Native5 265
Range
Area of Occupancy AOO218 984 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy72% within 1 km
≤100 m 36 588≤1 km 22 638≤10 km 22 386>10 km 346
81 958 georeferenced · 16 443 without coordinates
Open the mapobservation + sensor98 401
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 717≤1 km 3 322≤10 km 7 858>10 km 338
12 235 georeferenced · 3 361 without coordinates
Open the institutions mapphysical evidence15 596
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 4
4 georeferenced · 1 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions86 of 168 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 8 134 |
| Zürich, CH | 348 |
| Adam Mickiewicz University in Poznańlocation not on record | 324 |
| Brussel, BE | 289 |
| Bronx, US | 287 |
| LDlocation not on record | 271 |
| Swiss Federal Institute for Forest, Snow and Landscape Researchlocation not on record | 261 |
| Trondheim, NO | 220 |
| Knoxville, US | 202 |
| University of Gdansklocation not on record | 193 |
| Moscow State Universitylocation not on record | 184 |
| Olocation not on record | 183 |
| Akita Prefectural Museumlocation not on record | 147 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 144 |
| Chiba, JP | 138 |
| Garðabær, IS | 135 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 125 |
| PHlocation not on record | 125 |
| Saint Louis, US | 117 |
| Oulu, FI | 116 |
| Universitat Autònoma de Barcelonalocation not on record | 111 |
| Kuopio, FI | 111 |
| BDBClocation not on record | 105 |
| Frankfurt am Main | 105 |
| SLU Artdatabankenlocation not on record | 101 |
| Odawara, JP | 101 |
| Chicago, US | 97 |
| Tartu, EE | 97 |
| Ann Arbor, US | 94 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 86 |
| Madison, US | 83 |
| Vancouver, CA | 80 |
| Helsinki, FI | 77 |
| Tallinn, EE | 72 |
| Tilburg, NL | 60 |
| Philadelphia, US | 57 |
| Hiroshima Universitylocation not on record | 56 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 54 |
| Durham, US | 54 |
| Muzeum Górnośląskie w Bytomiulocation not on record | 53 |
| Uppsala, SE | 50 |
| WTUlocation not on record | 49 |
| MeiseBGlocation not on record | 44 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 43 |
| Salzburg, AT | 43 |
| Bando, JP | 40 |
| South Kensington, GB | 39 |
| US | 37 |
| CASlocation not on record | 37 |
| MAlocation not on record | 34 |
| Natural History Museum Rotterdamlocation not on record | 34 |
| Naturama Aargaulocation not on record | 33 |
| Oregon State Universitylocation not on record | 32 |
| IFR-DNFlocation not on record | 31 |
| Montréal, CA | 30 |
| Göteborg, SE | 29 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 28 |
| Universidad de Oviedolocation not on record | 27 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 27 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 26 |
| State Museum of Natural History of the National Academy of Sciences of Ukrainelocation not on record | 26 |
| Kunming, CN | 24 |
| Stockholm, SE | 24 |
| Madrid, ES | 22 |
| Minia, EG | 22 |
| MHN-UPlocation not on record | 21 |
| Frauenfeld, CH | 19 |
| Toyama, JP | 18 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 17 |
| St. Paul, US | 17 |
| University of Stellenboschlocation not on record | 17 |
| TROMlocation not on record | 15 |
| International Salmonella Centre (W.H.O.)location not on record | 14 |
| BRNUlocation not on record | 13 |
| Cincinnati, US | 13 |
| 13 | |
| College Park, US | 13 |
| Oskarshamn, SE | 13 |
| CJBGlocation not on record | 13 |
| McWane Science Centerlocation not on record | 12 |
| Beijing, CN | 12 |
| UAclocation not on record | 10 |
| nbflocation not on record | 10 |
| Mexico City, MX | 10 |
| SZUlocation not on record | 10 |
| Portland, US | 9 |
| Tsukuba, JP | 9 |
| Durham, US | 9 |
| Bourges, FR | 9 |
| CBDClocation not on record | 8 |
| Université Lavallocation not on record | 8 |
| GJOlocation not on record | 8 |
| Blacksburg, US | 7 |
| Davenport, US | 7 |
| Fort Hayslocation not on record | 6 |
| Porvoo, FI | 6 |
| Chapel Hill, US | 6 |
| Barcelona, ES | 6 |
| Provincia di Livornolocation not on record | 5 |
| Cambridge, US | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Tomioka, JP | 5 |
| Corvallis, US | 5 |
| Turku, FI | 5 |
| Forssa, FI | 5 |
| EL PASO, US | 4 |
| Edinburgh, GB | 4 |
| WINlocation not on record | 4 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 4 |
| Polar-Alpine Botanical Garden-Institutelocation not on record | 4 |
| Guizhou Agricultural Collegelocation not on record | 4 |
| Acadia Universitylocation not on record | 4 |
| Canberra, AU | 4 |
| Davis, US | 3 |
| MIVClocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Brisbane, AU | 3 |
| Kushiro City Museumlocation not on record | 3 |
| GZUlocation not on record | 3 |
| Toronto, CA | 3 |
| Logan, US | 3 |
| Archäologie und Museum Baselland - Museum.BLlocation not on record | 3 |
| New Brunswick, US | 3 |
| Edmonton, CA | 2 |
| Pittsburg, US | 2 |
| Lincoln, US | 2 |
| Metsähallituslocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Umeå Universitylocation not on record | 2 |
| Salamanca, ES | 2 |
| Durango, MX | 2 |
| Elikins, US | 2 |
| Western Carolina Universitylocation not on record | 2 |
| Decorah, US | 2 |
| Universidad de Málagalocation not on record | 2 |
| AADClocation not on record | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Auckland, NZ | 1 |
| Museo di Storia Naturale di Venezia Giancarlo Ligabue | Natural History Museum of Venice Giancarlo Ligabuelocation not on record | 1 |
| Morgantown, US | 1 |
| BioFokuslocation not on record | 1 |
| San Jose, US | 1 |
| Canadian Museum of Nature, Natural Heritage Collectionlocation not on record | 1 |
| Fayetteville, US | 1 |
| Granada, ES | 1 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Dhaka, BD | 1 |
| UNINE:NEUlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Dresden, DE | 1 |
| Millersville, US | 1 |
| kunlocation not on record | 1 |
| Bern, CH | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Hobart, AU | 1 |
| US | 1 |
| Jyväskylä, FI | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Paris, FR | 1 |
| UnBlocation not on record | 1 |
| University of Western Ontariolocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Honolulu, US | 1 |
| New Haven, US | 1 |
| Wlocation not on record | 1 |
| Mus�e des Confluenceslocation not on record | 1 |
168 institutions · 14 961 of 15 596 vouchered records shown · 634 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA12 detections
Where the DNA of Atrichum undulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map5 countries0
lowland rain forest of Thuja Tsuga and Acer …moist woods
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.4 °C 2.60–15.2
Seasonal swing summer↔winter21.9 °C
Max temp (day)12.8 °C 5.00–17.8
Min temp (night)7.80 °C 0.5–11.8
Precipitation83.7 mm/mo 72.2–128
Air humidity63.6 % 60.7–66.5
Moisture balance33.7 mm/mo -19.9–67.5
Vapour deficit463 Pa 236–653
Wind speed3.90 m/s 2.70–4.80
Cloud cover50.7 % 46.3–63.4
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.