Atractylodes macrocephala

Koidz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Atractylodes

At a glance

Occurrence records214

Data sources12

Biological traits15

DNA specimens8

eDNA detections8

Sources12 archives

Databases and archives Atractylodes macrocephala's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility214 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionLOTUS · NPASS267 compounds

Occurrence & distributionGBIF214 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Atractylodes macrocephala Koidz., bái zhú 白术 is a species of Atractylodes that grows in central China. The roots are consumed as a Chinese herbal medicine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology9

Fruit length7.5 mm

Fruit length max7.5 mm

Fruit length min7.5 mm

Leaf length35 mm

Leaf length max40 mm

Leaf length min30 mm

Plant height0.4 m

Plant height max0.6 m

Plant height min0.2 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

Woodinessnon-woody

03Chemical composition267 compounds

Compounds documented for Atractylodes macrocephala across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids42

Aromadendrane sesquiterpenoids19

Fatty aldehydes15

Hydrocarbons9

Guaiane sesquiterpenoids9

Documented compounds267 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Camphene	present	NPASS
(-)-Camphene	present	NPASS
(-)-Caryophyllene	present	NPASS
(-)-Dehydroaromadendrene	present	NPASS
(-)-Menthol	present	NPASS
(1aR,4aR,7S,7aS,7bS)-1,1,7-trimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa(e)azulene	present	NPASS
(1aR,4R,7R,7bS)-1,1,4,7-Tetramethyl-1a,2,3,4,5,6,7,7b-octahydro-1H-cyclopropa(e)azulene	present	NPASS
(1aS,4aS,7aS,7bR)-1,1,7-trimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulene	present	NPASS
(1R,4aR,8aR)-1,4a-dimethyl-7-propan-2-ylidene-3,4,5,6,8,8a-hexahydro-2H-naphthalen-1-ol	present	LOTUS
(1R,4R,5R,9S)-4,5-epoxycaryophyllan-8(13)-ene	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atractylodes macrocephala has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV483205.1 ↗229 bpChina · 2025

ACGT

CGCATCGCGTCGCCCCCGACCACGCCTCCCCCACGGGGACGCGTGTCGTCGGGGGCGGAGATTGGTCTCCCGTGCCCACGGCGCGGCTGG …

Atractylodes macrocephala voucher CA17 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Atractylodes macrocephala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Cheng, Y. c., B. k. Liu, Z. s. Jiang & Y. c. Duan. 1991. Observations of chromosome numbers of several medical plants. J. Hunan Agric. Coll. 11(2): 166–170.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type214 records

Wild obs. + sensor1

Museum / vouchered213

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 213 records without

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Changsha, CN	35
Nanjing, CN	25
Beijing, CN	24
Wuhan, CN	18
黔东南州民族医药研究所标本室location not on record	13
Chengdu, CN	9
FJIDClocation not on record	8
Guangzhou, CN	8
Yangling, CN	8
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	7
Chengdu, CN	5
Zhejiang Museum of Natural Historylocation not on record	5
Saint Louis, US	4
Zhengzhou, CN	4
Strecker Museum, Baylor Universitylocation not on record	4
Kunming, CN	3
Central China Normal Universitylocation not on record	3
WNNUlocation not on record	3
Wuhan, CN	3
Hangzhou, CN	3
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	3
Guilin, CN	2
Xining, CN	2
Shanghai, CN	2
Chengdu, CN	2
Zhejiang Universitylocation not on record	1
Kew, GB	1
Jiujiang Forestry Institutelocation not on record	1
Guangzhou, CN	1
Xiamen, CN	1
Seoul, KR	1
Zhuzhou, CN	1
South China Normal Universitylocation not on record	1
Yunnan Universitylocation not on record	1
Xian, CN	1

35 institutions · 213 of 213 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Atractylodes macrocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)