Atractomorpha similis

Bolívar, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Pyrgomorphidae/Atractomorpha

At a glance

Occurrence records468

Data sources7

Biological traits0

DNA specimens9

eDNA detections10

Sources7 archives

Databases and archives Atractomorpha similis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility468 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF468 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Atractomorpha similis, commonly known as the northern grass pyrgomorph, is a species of grasshopper in the genus Atractomorpha. It occurs in Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atractomorpha similis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BINs2

Most divergent pair2.7%

Where individuals differ — all 21 variable positions, in barcode order

1Avariable

76Gmostly conserved

154Cmostly conserved

178Tmostly conserved

184Amostly conserved

214Cvariable

277Tmostly conserved

328Amostly conserved

340Cmostly conserved

352Amostly conserved

373Cmostly conserved

418Amostly conserved

433Gmostly conserved

445Cmostly conserved

529Cvariable

536Cmostly conserved

539Cmostly conserved

556Amostly conserved

616Cvariable

619Gvariable

628Amostly conserved

AACTCTATACTTCTTGTTTGGTGCATGATCAGGAATAATAGGAACATCAATGAGAATAATAATCCGGGCAGAACTGGGTCAACCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atractomorpha crenulatasame genus10.0%Atractomorpha sinensissame genus10.0%Atractomorpha psittacinasame genus10.2%Atractomorpha latasame genus10.5%Acrida exaltatasame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type468 records

Wild obs. + sensor429

Museum / vouchered39

Range

Area of Occupancy AOO1 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 149≤1 km 71≤10 km 13>10 km 23

256 georeferenced · 173 without coordinates

Open the mapobservation + sensor429

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	29
Natick, US	4
Stockholm, SE	3
Colorado State Universitylocation not on record	1

4 institutions · 37 of 39 vouchered records shown · 2 without an institution code

09Environmental DNA10 detections

Where the DNA of Atractomorpha similis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 21.3–27.3

Seasonal swing summer↔winter7.90 °C

Max temp (day)27.9 °C 23.1–30.4

Min temp (night)21.9 °C 19.4–24.0

Precipitation69.4 mm/mo 34.7–135

Air humidity59.9 % 57.7–64.4

Moisture balance-61.3 mm/mo

Vapour deficit1,298 Pa 916–1,410

Wind speed2.90 m/s

Cloud cover36.3 % 30.5–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)