Atractocarpus stipularis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Atractocarpus

At a glance

Occurrence records15

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Atractocarpus stipularis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF15 records

DNA & barcodingNCBIsequences

01Narrative

Atractocarpus stipularis, commonly known as the green plum, is a flowering plant in the coffee family. The specific epithet alludes to its large stipules.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology7

Fruit length17.5 mm

Fruit width2.5 mm

Leaf length175 mm

Leaf length max200 mm

Leaf length min150 mm

Leaf width47.5 mm

Plant height13 m

⚠ sources differ — GIFT: 13 m · AusTraits: 12 m

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscencedehiscent

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapewidely_ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atractocarpus stipularis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMK165303.1 ↗668 bp

ACGT

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAGAGCAGACGACCGCGAACCTGTGTGACCGCCGGGCGCCGGGGGA …

Atractocarpus stipularis voucher Bremer 2734 (S) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor10

Museum / vouchered5

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 7≤1 km 1≤10 km 1>10 km 1

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	2

1 institutions · 2 of 5 vouchered records shown · 3 without an institution code