Atractocarpus merikin

(F.M.Bailey) Puttock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Atractocarpus

At a glance

Occurrence records150

Data sources6

Biological traits29

DNA specimens6

eDNA detections2

Sources6 archives

Databases and archives Atractocarpus merikin's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF150 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Atractocarpus merikin là một loài thực vật có hoa trong họ Thiến thảo. Loài này được (F.M.Bailey) Puttock mô tả khoa học đầu tiên năm 1999.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length52.5 mm

Fruit width35 mm

Leaf length120 mm

Leaf mass285 mg

Leaf mass per area63.69 g/m2

Leaf size4 601 mm²

Leaf width60 mm

Plant height5 m

Plant height max3 m

Plant height min1 m

Seed length7 mm

Seed width4.5 mm

Life cycle & reproduction6

Flowering timeyynnnnnnnyyy

Life formtree

Life spanperennial

Pollination syndromemoth

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Wood density804 mg/cm³

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atractocarpus merikin has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK165289.1 ↗668 bp

ACGT

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAGAGCAGACGACCGCGAACCTGTGTGACCGCCGGGCGCCGGGGGA …

Atractocarpus merikin voucher Webb 11457 (P) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type150 records

Wild obs. + sensor20

Museum / vouchered117

Other13

Origin

Native3

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 8≤1 km 6≤10 km 3

17 georeferenced · 3 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 14≤1 km 15≤10 km 32>10 km 8

69 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	65
Brisbane, AU	32
John T. Waterhouse Herbariumlocation not on record	5
Mount Annan, AU	3
Canberra, AU	3
Museo Entomologico de Leonlocation not on record	2
James Cook Townsvillelocation not on record	2
Australian Tropical Herbariumlocation not on record	2
Kew, GB	1

9 institutions · 115 of 117 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Atractocarpus merikin was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 22.8–23.0

Seasonal swing summer↔winter7.10 °C

Max temp (day)26.5 °C 25.7–27.3

Min temp (night)19.5 °C 19.2–19.7

Precipitation209 mm/mo 175–242

Air humidity69.0 % 67.3–70.6

Moisture balance38.7 mm/mo 5.40–71.9

Vapour deficit867 Pa 816–918

Wind speed1.50 m/s 1.30–1.80

Cloud cover40.9 % 33.9–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)