Atractocarpus hirtus

(F.Muell.) Puttock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Atractocarpus

At a glance

Occurrence records424

Data sources8

Biological traits33

DNA specimens8

eDNA detections4

Sources8 archives

Databases and archives Atractocarpus hirtus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF424 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Atractocarpus hirtus, commonly known as the hairy gardenia or native loquat, is a plant in the madder family Rubiaceae, a large family of some 6,500 species with a cosmopolitan distribution. This species is endemic to north-east Queensland, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length40 mm

Fruit width23 mm

Leaf length145 mm

Leaf mass153 mg

Leaf mass per area43.34 g/m2

Leaf size4 716 mm²

Leaf width62.5 mm

Plant height4 m

Plant height max2 m

Plant height min1 m

Seed length7 mm

Seed mass32 mg

Seed width3.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnyyyyyyyn

Life formshrub or tree

Life spanperennial

Pollination syndromemoth

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)13.89 mm²/mg

Wood density819 mg/cm³

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atractocarpus hirtus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK165287.1 ↗668 bp

ACGT

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAGAGCAGACGACCGCGAACCTGTGTGACCGCCGGGCGCCGGGGGA …

Atractocarpus hirtus voucher Fosberg 61489 (P) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type424 records

Wild obs. + sensor177

Museum / vouchered207

Cultivated / captive1

Other39

Origin

Native7

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 86≤1 km 38≤10 km 8>10 km 6

138 georeferenced · 39 without coordinates

Open the mapobservation + sensor177

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 28≤1 km 32≤10 km 55>10 km 41

156 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence207

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	73
Brisbane, AU	66
Museo Entomologico de Leonlocation not on record	22
Canberra, AU	14
Mount Annan, AU	8
John T. Waterhouse Herbariumlocation not on record	7
James Cook Townsvillelocation not on record	3
Australian Tropical Herbariumlocation not on record	3
Adelaide, AU	2
Zürich, CH	1
Armidale, AU	1

11 institutions · 200 of 207 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Atractocarpus hirtus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 21.4–23.8

Seasonal swing summer↔winter5.80 °C

Max temp (day)23.8 °C 22.4–27.5

Min temp (night)20.4 °C 16.6–22.8

Precipitation87.4 mm/mo 37.1–169

Air humidity62.6 % 49.1–62.8

Moisture balance-6.90 mm/mo

Vapour deficit1,053 Pa 943–1,486

Wind speed3.40 m/s

Cloud cover35.4 % 23.3–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)