Atractocarpus heterophyllus

(Montrouz.) Guillaumin & Beauvis. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Atractocarpus

At a glance

Occurrence records116

Data sources7

Biological traits14

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Atractocarpus heterophyllus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF116 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Atractocarpus heterophyllus is a species of flowering plant in the family Rubiaceae. The plant is native to southeastern New Caledonia.Mouly, A. 2013. On the distinction of Atractocarpus heterophyllus (Montrouz.) Guillaumin & Beauvis. and A. bracteatus Schltr. & K. Krause (Rubaiceae): in search of the correct name for the type species of Atractocarpus Schltr. & K. Krause. Adansonia, sér. 3, 34(1): 103–114.Guillaumin, André & Georges Beauvisage. 1914. Annales de la Société Botanique de Lyon 38: 96. Atractocarpus heterophyllusJean Xavier Hyacinthe Montrouzier. 1860. Mémoires de l'Académie Royale des Sciences, Belles-Lettres et Arts de Lyon : Section des Sciences 10: 216 Gardenia heterophylla

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Leaf size140 mm²

Plant height2.11 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTrain forest

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)5.41 mm²/mg

Wood density610 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atractocarpus heterophyllus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSMK165286.1 ↗669 bp

ACGT

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCGAAGCAGACGACCGCGAACCTGTGTGACCGCCGGGCGCCGGGGGA …

Atractocarpus heterophyllus voucher Mouly 850 (P) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type116 records

Wild obs. + sensor5

Museum / vouchered111

Origin

Native2

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Strasbourglocation not on record	77
Paris, FR	23
Mount Annan, AU	2
Kew, GB	1
Zürich, CH	1

5 institutions · 104 of 111 vouchered records shown · 7 without an institution code

09Environmental DNA3 detections

Where the DNA of Atractocarpus heterophyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)