Atractocarpus fitzalanii

(F.Muell.) Puttock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Atractocarpus

At a glance

Occurrence records469

Data sources9

Biological traits19

DNA specimens9

eDNA detections4

Sources9 archives

Databases and archives Atractocarpus fitzalanii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility469 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF469 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Atractocarpus fitzalanii, the brown gardenia or yellow mangosteen, is a species of flowering plant in the family Rubiaceae found in tropical Queensland in Australia. The beautifully scented flowers and lush growth has seen this plant enter cultivation in subtropical gardens in Eastern Australia.Society for Growing Australian Plants (Aitkenvale Queensland), Atractocarpus fitzalanii

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Plant height4.5 m

Seed length6.82 mm

Seed mass106 mg

Seed width5.19 mm

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: shrub/tree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density719 mg/cm³

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atractocarpus fitzalanii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes6

GenBank sequences5

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOL536371.1 ↗335 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGAATC …

Atractocarpus fitzalanii voucher MO:Carlsen3556 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type469 records

Wild obs. + sensor299

Museum / vouchered115

Cultivated / captive3

Other52

Origin

Native9

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 156≤1 km 40≤10 km 8>10 km 21

225 georeferenced · 74 without coordinates

Open the mapobservation + sensor299

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 3≤1 km 42≤10 km 29>10 km 2

76 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence115

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	41
Museo Entomologico de Leonlocation not on record	15
Smithfield, AU	13
Mount Annan, AU	9
Palmerston, AU	4
University of Stellenboschlocation not on record	3
BISHlocation not on record	3
Kew, GB	2
Hobart, AU	2
Honolulu, US	2
Brisbane, AU	1
Beijing, CN	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Adelaide, AU	1

15 institutions · 99 of 115 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Atractocarpus fitzalanii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 16.9–26.1

Seasonal swing summer↔winter8.30 °C

Max temp (day)28.8 °C 21.6–29.0

Min temp (night)19.0 °C 12.7–23.7

Precipitation125 mm/mo 54.5–134

Air humidity60.1 % 57.6–63.8

Moisture balance-45.8 mm/mo

Vapour deficit1,235 Pa 799–1,253

Wind speed3.40 m/s

Cloud cover36.4 % 30.7–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)