Atoposmia elongata

(Michener, 1936) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Atoposmia

At a glance

Occurrence records146

Data sources6

Biological traits0

DNA specimens14

eDNA detections3

Sources6 archives

Databases and archives Atoposmia elongata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF146 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD14 specimens

01Narrative

Atoposmia elongata is een vliesvleugelig insect uit de familie Megachilidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1936 door Michener.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atoposmia elongata has left across the world's sequence archives.

At a glance

DNA specimens14

BINs5

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

2Gmostly conserved

31Cmostly conserved

40Tmostly conserved

43Amostly conserved

46Tmostly conserved

97Cvariable

158Tmostly conserved

200Gmostly conserved

214Avariable

217Amostly conserved

226Tmostly conserved

238Tmostly conserved

253Cmostly conserved

295Amostly conserved

307Amostly conserved

310Tmostly conserved

316Ahighly variable

340Cvariable

358Cmostly conserved

364Cmostly conserved

370Tmostly conserved

373Tmostly conserved

385Tmostly conserved

460Cmostly conserved

478Tmostly conserved

490Cvariable

505Tmostly conserved

515Gmostly conserved

550Tmostly conserved

559Tmostly conserved

586Cmostly conserved

595Cmostly conserved

598Tmostly conserved

616Tmostly conserved

622Gvariable

625Amostly conserved

628Avariable

634Cmostly conserved

AGTTCTTTACATAATTTTTGCTATATGATCCGGAATAATTGGATCTGCAATAAGAATTATTATTCGAATAGAATTAAGAATTCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes10

BINs5

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atoposmia triodontasame genus7.4%Atoposmia abjectasame genus7.9%Atoposmia oregonasame genus7.9%Atoposmia anthodytasame genus7.9%Ashmeadiella cactorumsame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type146 records

Wild obs. + sensor1

Museum / vouchered145

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	129
Wuzhou, CN	6
	5
Zürich, CH	2
Weber State University, Bird and Mammal Collectionlocation not on record	2
WSUClocation not on record	1

6 institutions · 145 of 145 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Atoposmia elongata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 12.3–12.4

Seasonal swing summer↔winter18.6 °C

Max temp (day)19.4 °C 19.3–19.5

Min temp (night)6.60 °C

Precipitation59.7 mm/mo 56.5–62.8

Air humidity57.2 % 56.3–58.2

Moisture balance-78.3 mm/mo -89.5–-67.1

Vapour deficit620 Pa 604–636

Wind speed3.00 m/s 2.50–3.60

Cloud cover33.6 % 33.2–34.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)