Athyrium asplenioides

(Michx.) Desv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Athyriaceae/Athyrium

At a glance

Occurrence records6 799

Data sources7

Biological traits9

DNA specimens5

eDNA detections3

Sources7 archives

Databases and archives Athyrium asplenioides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 799 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF6 799 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 80

01Narrative

Asplenium athyrium là một loài dương xỉ trong họ Aspleniaceae. Loài này được Spreng. mô tả khoa học đầu tiên năm 1804. Danh pháp khoa học của loài này chưa được làm sáng tỏ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Athyrium asplenioides has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP643868.1 ↗540 bpUSA

ACGT

AAAGCTGGTGTCAGAGATTACCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACC …

Athyrium asplenioides voucher SCBI-SIGEO_13_0328a ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Athyrium asplenioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 401×CCDB · book-ipcn66

CCDB · book-ipcn66 — Wagner & Wagner 1966

08Occurrence & distribution

Record type6 799 records

Wild obs. + sensor6 762

Museum / vouchered36

Cultivated / captive1

Range

Area of Occupancy AOO16 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 3 992≤1 km 824≤10 km 292>10 km 644

5 752 georeferenced · 1 010 without coordinates

Open the mapobservation + sensor6 762

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 1≤1 km 1≤10 km 4>10 km 1

7 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence36

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	8
University of Stellenboschlocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Smithsonian Institutionlocation not on record	4
Auckland, NZ	3
Durham, US	2
EL PASO, US	1
Cambridge, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Tempe, US	1
St. Paul, US	1
Edinburgh, GB	1

12 institutions · 32 of 36 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Athyrium asplenioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 14.0–23.2

Seasonal swing summer↔winter23.3 °C

Max temp (day)28.5 °C 19.2–28.5

Min temp (night)17.9 °C 9.00–17.9

Precipitation101 mm/mo 93.0–101

Air humidity56.5 % 55.8–56.5

Moisture balance-57.1 mm/mo -57.1–-7.10

Vapour deficit1,238 Pa 794–1,238

Wind speed2.40 m/s 2.40–2.90

Cloud cover31.5 % 31.5–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Athyrium asplenioides

At a glance

Sources7 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 799 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 799 records