Atherina hepsetus

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Chordata/Atheriniformes/Atherinidae/Atherina

At a glance

Occurrence records1 278

Data sources10

Biological traits0

DNA specimens29

eDNA detections29

Sources10 archives

Databases and archives Atherina hepsetus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility910 records↗

OBISOcean Biodiversity Information System368 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS1 278 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD29 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

Atherina hepsetus, communément nommé en français Sauclet ou Athérine, est une espèce de poissons de la famille des Atherinidae. Son nom binominal vient du grec αθερί να εψητός atherí na ’epsêtós soit « frais à friture ».

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atherina hepsetus has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections29

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 17 variable positions, in barcode order

2Cmostly conserved

4Cmostly conserved

5Cmostly conserved

7Tmostly conserved

8Amostly conserved

9Tmostly conserved

15Tmostly conserved

93Amostly conserved

195Amostly conserved

204Tmostly conserved

435Tvariable

441Cmostly conserved

453Tmostly conserved

555Amostly conserved

564Cmostly conserved

620Gmostly conserved

633Cmostly conserved

CCTCCTTATGTATTTGGTGCTTGAGCCGGGATAGTCGGGACTGCTCTAAGCCTCCTAATTCGGGCGGAACTGAGCCAACCCGGCTCCCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atherina presbytersame genus6.4%Atherina boyerisame genus10.1%Atherinomorus forskaliisame family15.8%Myripristis kunteesame order16.1%Acanthochromis polyacanthussame order16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Atherina hepsetus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 033 441 561 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atherina hepsetus1.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 278 records

Wild obs. + sensor1 053

Museum / vouchered147

Other78

Origin

Native64

Range

Area of Occupancy AOO1 184 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 15 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 188≤1 km 163≤10 km 72>10 km 28

451 georeferenced · 602 without coordinates

Open the mapobservation + sensor1 053

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 6

9 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence147

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	70
Paris, FR	19
	14
Cambridge, US	6
Stockholm, SE	4
SNSB-Zoologische Staatssammlung Münchenlocation not on record	3
Barcelona, ES	2
ICM-CSIClocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Helsinki, FI	1
Washington, US	1
Ann Arbor, US	1
South African Institute for Aquatic Biodiversitylocation not on record	1

13 institutions · 124 of 147 vouchered records shown · 1 without an institution code

09Environmental DNA29 detections

Where the DNA of Atherina hepsetus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atherina hepsetus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 278 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 278 records