Atherigona reversura

Villeneuve, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Muscidae/Atherigona

At a glance

Occurrence records338

Data sources6

Biological traits0

DNA specimens2 247

eDNA detections1 957

Sources6 archives

Databases and archives Atherigona reversura's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility338 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 957 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 247 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF338 records

Environmental DNA1 datasets · 13 countries1 957 detections

DNA & barcodingBOLD2 247 specimens

01Narrative

Atherigona reversura, bermudagrass stem maggot, body size: 3.1 mm Atherigona reversura, bermudagrass stem maggot Atherigona reversura, bermudagrass stem maggot, body size 4 mm Atherigona reversura, the bermudagrass stem maggot, is a muscid shoot-fly. The genus comprises more than 220 species, and some of them are very damaging pests in agriculture. The bermudagrass stem maggot takes its name from its host preference for bermudagrass (Cynodon dactylon) and stargrass (Cynodon nlemfuensis).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 247 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atherigona reversura has left across the world's sequence archives.

At a glance

DNA specimens2 247

BINs2

Marker genes1

eDNA detections1 957

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus2 237 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

5Amostly conserved

8Tmostly conserved

65Amostly conserved

200Tmostly conserved

204Cmostly conserved

210Cmostly conserved

338Tmostly conserved

410Amostly conserved

446Tmostly conserved

534Tmostly conserved

545Amostly conserved

569Tmostly conserved

575Gmostly conserved

576Tmostly conserved

579Cmostly conserved

587Cmostly conserved

593Tmostly conserved

614Cmostly conserved

647Gvariable

CTCTATATTTTATTTTTGGAGCTTGATCCGGAATAGTAGGAACTTCTCTAAGAATTTTAATTCGAGCTGAATTAGGTCACCCTGGAGCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 108 variants.

Diversity (π)0.86%

Haplotypes108

BINs2

Most divergent pair3.5%

N.AmericaAsiaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atherigona punctatasame genus2.3%Atherigona variasame genus6.1%Atherigona soccatasame genus6.7%Atherigona orientalissame genus7.6%Atherigona theodorisame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type338 records

Wild obs. + sensor246

Museum / vouchered92

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 111≤1 km 38≤10 km 12>10 km 28

189 georeferenced · 57 without coordinates

Open the mapobservation + sensor246

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 92 records without

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	60
Helsinki, FI	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7

3 institutions · 82 of 92 vouchered records shown · 10 without an institution code

09Environmental DNA1 957 detections

Where the DNA of Atherigona reversura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 957

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 957 detections have coordinates

Open the map13 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 18.1–28.1

Seasonal swing summer↔winter8.30 °C

Max temp (day)26.2 °C 23.6–34.0

Min temp (night)18.6 °C 12.8–25.0

Precipitation115 mm/mo 11.8–332

Air humidity63.5 % 45.9–76.7

Moisture balance6.60 mm/mo -144–218

Vapour deficit1,073 Pa 599–1,878

Wind speed2.00 m/s 1.20–3.80

Cloud cover31.3 % 16.7–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 1 953 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)