Atheniella flavoalba

(Fr.) Redhead, Moncalvo, Vilgalys, Desjardin & B.A.Perry · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Mycenaceae/Atheniella

At a glance

Occurrence records10 298

Data sources8

Biological traits0

DNA specimens26

eDNA detections198

Sources8 archives

Databases and archives Atheniella flavoalba's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 298 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI198 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 298 records

Environmental DNA5 datasets · 16 countries198 detections

DNA & barcodingBOLD · NCBI26 specimens

01Narrative

Mycena flavoalba, commonly known as the ivory bonnet, is a species of inedible mushroom in the family Mycenaceae. The cap is initially conical in shape, before becoming convex and then flattening out; it may reach dimensions of up to 1.5 cm across. The cap color is ivory-white to yellowish white, sometimes more yellowish at the center. The tubular stems are up to 8 cm long and 2.5 mm thick, and have long, coarse white hairs at their bases. The mushroom is found in Europe, the Middle East, and North America, where it grows scattered or in dense groups under conifers and on humus in oak woods.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atheniella flavoalba has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes2

GenBank sequences9

eDNA detections198

Countries16

The DNA barcodea real sequence read deposited for this species

ITSOM745552.1 ↗351 bpChina

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAAGTTTAATTGGAGTTGTAGCTGACTGCTTCGGCAGTATGT …

Mycena flavoalba voucher b762046d3d44907607238cd2d92df6ac small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type10 298 records

Wild obs. + sensor9 910

Museum / vouchered343

Other45

Range

Area of Occupancy AOO21 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 3 974≤1 km 1 840≤10 km 3 417>10 km 15

9 246 georeferenced · 664 without coordinates

Open the mapobservation + sensor9 910

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 107≤1 km 110≤10 km 54>10 km 6

277 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence343

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	95
Helsinki, FI	22
University of Oslo, Natural History Museumlocation not on record	18
Trondheim, NO	16
TROMlocation not on record	15
SLU Artdatabankenlocation not on record	15
Universidade de Lisboa, Museu Bocagelocation not on record	12
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	9
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
Salzburg, AT	6
Copenhagen, DK	5
nsnflocation not on record	5
Kuopio, FI	4
Karlsruhe, DE	4
WU-MYClocation not on record	4
BDBClocation not on record	3
CJBGlocation not on record	3
PRClocation not on record	2
Oulu, FI	2
Turku, FI	2
JA-CAGPDS-CAMlocation not on record	1
Tromso University Museumlocation not on record	1
Personal Herbarium of Renee LeBeuflocation not on record	1
Gijón, ES	1
TUR-Alocation not on record	1
Denver, US	1
San Sebastián, ES	1
Auckland, NZ	1
Lausanne, CH	1

29 institutions · 257 of 343 vouchered records shown · 85 without an institution code

09Environmental DNA198 detections

Where the DNA of Atheniella flavoalba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found198

Studies independent surveys5

Countries16

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 198 detections have coordinates

Open the map16 countries0

in moss and grass in an open area in conifer…Blabaergranskog; [Substrat:] Pa stro under g…I mose og gras i apen skogsbryning pa as med…in grass, forest border young Picea forest c…Rich grey alderine forest on glacial clayApen grasmark, beitemark

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 1.30–17.6

Seasonal swing summer↔winter22.3 °C

Max temp (day)14.3 °C 3.90–21.6

Min temp (night)6.50 °C -1.30–13.8

Precipitation77.5 mm/mo 48.2–207

Air humidity61.7 % 58.3–67.5

Moisture balance11.2 mm/mo -44.9–156

Vapour deficit508 Pa 260–808

Wind speed3.50 m/s 2.30–6.20

Cloud cover41.8 % 35.7–60.2

CHELSA 1981–2010, ~9 km grid, at location & month of 192 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atheniella flavoalba

At a glance

Sources8 archives

At a glance

Record type10 298 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 298 records