Athene brama

(Temminck, 1821) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Strigiformes/Strigidae/Athene

At a glance

Occurrence records200 434

Data sources10

Biological traits27

DNA specimens10

eDNA detections9

Sources10 archives

Databases and archives Athene brama's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 434 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF200 434 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT2n = 82

01Narrative

The spotted owlet (Athene brama) is a small owl which breeds in tropical Asia from mainland India to Southeast Asia. A common resident of open habitats including farmland and human habitation, it has adapted to living in cities. They roost in small groups in the hollows of trees or in cavities in rocks or buildings. It nests in a hole in a tree or building, laying 3–5 eggs. They are often found near human habitation. The species shows great variation including clinal variation in size and forms a superspecies with the very similar little owl.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth11.3 mm

Beak length (culmen)19.7 mm

Beak length (nares)12.4 mm

Beak width7.5 mm

Body mass113 g

Body mass (male)114 g

Hand-wing index29.2

Kipp's distance44.5 mm

SVL20 cm

Secondary length108 mm

Tail length74.2 mm

Tarsus length25.6 mm

Wing length153 mm

Life cycle & reproduction2

Egg mass12.5 g

Litter size3.5

Diet & foraging8

Ground60 %

Invertebrate70 %

Midhigh30 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory10 %

Vertebrate ectotherm10 %

Vertebrate endotherm20 %

Habitat & environment4

HabitatHuman Modified

Migration1.0

Primary lifestyleInsessorial

Range size5 213 398 km²

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Athene brama has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections9

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 133 variable positions, in barcode order

27Tmostly conserved

58Tmostly conserved

63Gvariable

66Tmostly conserved

75Cmostly conserved

78Tvariable

84Amostly conserved

85Amostly conserved

87Cmostly conserved

90Cmostly conserved

93Cmostly conserved

99Cmostly conserved

105Tmostly conserved

108Tmostly conserved

111Avariable

123Gmostly conserved

126Tmostly conserved

132Amostly conserved

133Amostly conserved

141Tmostly conserved

144Amostly conserved

147Cmostly conserved

150Tmostly conserved

153Gmostly conserved

160Tvariable

162Amostly conserved

165Cmostly conserved

168Amostly conserved

169Tmostly conserved

171Amostly conserved

177Tmostly conserved

180Amostly conserved

183Cmostly conserved

186Amostly conserved

192Gmostly conserved

195Cmostly conserved

207Gmostly conserved

210Cmostly conserved

213Cmostly conserved

216Amostly conserved

219Cmostly conserved

228Amostly conserved

231Amostly conserved

234Cmostly conserved

237Cmostly conserved

241Tmostly conserved

244Amostly conserved

246Amostly conserved

249Cmostly conserved

252Cmostly conserved

253Cmostly conserved

258Amostly conserved

264Tmostly conserved

273Amostly conserved

276Cmostly conserved

279Gvariable

281Cmostly conserved

282Amostly conserved

285Tmostly conserved

291Amostly conserved

303Cmostly conserved

306Amostly conserved

309Tmostly conserved

310Cmostly conserved

315Cmostly conserved

316Gmostly conserved

318Cmostly conserved

322Tmostly conserved

324Gmostly conserved

330Cmostly conserved

333Cmostly conserved

339Tmostly conserved

351Amostly conserved

354Amostly conserved

357Cmostly conserved

360Cmostly conserved

363Tmostly conserved

366Tmostly conserved

370Cmostly conserved

372Gmostly conserved

375Cmostly conserved

378Amostly conserved

379Gmostly conserved

381Amostly conserved

384Cmostly conserved

391Cmostly conserved

393Amostly conserved

396Gmostly conserved

408Cmostly conserved

411Cmostly conserved

417Tmostly conserved

420Cmostly conserved

435Amostly conserved

439Tmostly conserved

441Cmostly conserved

442Tmostly conserved

444Gmostly conserved

445Tmostly conserved

447Amostly conserved

450Gmostly conserved

451Cmostly conserved

456Amostly conserved

459Cmostly conserved

463Tmostly conserved

465Amostly conserved

468Tmostly conserved

471Gmostly conserved

474Amostly conserved

477Cmostly conserved

480Amostly conserved

483Tmostly conserved

486Cmostly conserved

489Tmostly conserved

492Tmostly conserved

498Cmostly conserved

504Cmostly conserved

510Tmostly conserved

513Cmostly conserved

516Tvariable

520Cmostly conserved

+13 more variable positions not shown

GCTGGAACAGCCCTAAGCCTGCTAATTCGAGCCGAACTCGGGCAACCCGGAACTCTTTTAGGGGATGACCAAATCTATAACGTAATCGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.7%

Haplotypes3

BINs3

Most divergent pair3.0%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Athene noctuasame genus12.6%Surnia ululasame family13.5%Asio flammeussame family13.7%Otus eleganssame family14.1%Glaucidium cuculoidessame family14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Athene brama carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 82 n = 41

Chromosome records82–822n range82median82mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 822×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

08Occurrence & distribution

Record type200 434 records

Wild obs. + sensor200 420

Museum / vouchered13

Other1

Origin

Native3

Range

Area of Occupancy AOO87 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 378≤1 km 2 110≤10 km 614>10 km 280

4 382 georeferenced · 196 038 without coordinates

Open the mapobservation + sensor200 420

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 2

8 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	3
Bourges, FR	2
Toronto, CA	2
Ann Arbor, US	2
Iowa City, US	1
Geneva, CH	1
ZMAAlocation not on record	1

7 institutions · 12 of 13 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Athene brama was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 22.1–25.7

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 27.5–30.7

Min temp (night)19.3 °C 15.3–20.2

Precipitation109 mm/mo 74.4–115

Air humidity52.0 % 51.1–55.4

Moisture balance-17.8 mm/mo -45.7–-16.0

Vapour deficit1,616 Pa 1,483–1,616

Wind speed1.80 m/s 1.70–1.90

Cloud cover25.2 % 24.7–35.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Athene brama

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging8

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type200 434 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type200 434 records