Atheloca subrufella

Hulst, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Atheloca

At a glance

Occurrence records112

Data sources7

Biological traits0

DNA specimens27

eDNA detections17

Sources7 archives

Databases and archives Atheloca subrufella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 3 countries17 detections

DNA & barcodingBOLD27 specimens

01Narrative

Atheloca subrufella, the palm bud moth or coconut moth, is a species of snout moth described by George Duryea Hulst in 1887. It is found in the US states of Georgia and Florida, and in northern Mexico, Cuba, the Virgin Islands and Brazil. The wingspan is 14–18 mm. Adults are brownish. The larvae feed on various species in the family Arecaceae, including Cocos, Attalea, Syagrus, Sabal and Serenoa species. They are one of the most important coconut pests. Young larvae feed on the carpels of still-tender flowers or, if the flower has already been fertilized, they penetrate the developing coconut through the lower part of the bracts. In young coconuts, the larvae feed on the mesocarp, opening a series of galleries and causing premature shedding of fruits.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atheloca subrufella has left across the world's sequence archives.

At a glance

DNA specimens27

BINs3

Marker genes1

eDNA detections17

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 104 variable positions, in barcode order

14Amostly conserved

18Tmostly conserved

19Cvariable

21Gmostly conserved

23Amostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Tvariable

43Amostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Cmostly conserved

60Tmostly conserved

62Amostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

73Amostly conserved

75Tmostly conserved

82Tmostly conserved

88Amostly conserved

91Amostly conserved

100Amostly conserved

115Tvariable

133Avariable

139Amostly conserved

184Amostly conserved

187Tvariable

205Amostly conserved

212Tvariable

217Avariable

223Amostly conserved

226Tmostly conserved

232Amostly conserved

235Tmostly conserved

241Amostly conserved

256Amostly conserved

263Amostly conserved

265Amostly conserved

274Tmostly conserved

283Amostly conserved

298Avariable

307Amostly conserved

325Tmostly conserved

328Avariable

334Tmostly conserved

346Cvariable

364Cvariable

367Tmostly conserved

370Tmostly conserved

376Amostly conserved

379Amostly conserved

382Tmostly conserved

386Tmostly conserved

388Amostly conserved

401Tvariable

406Tmostly conserved

412Avariable

436Tmostly conserved

442Tvariable

451Amostly conserved

457Tvariable

470Tvariable

478Amostly conserved

484Tmostly conserved

508Tvariable

512Gmostly conserved

520Tmostly conserved

539Cmostly conserved

541Tmostly conserved

542Tvariable

557Tvariable

562Tmostly conserved

581Tvariable

586Tmostly conserved

596Tmostly conserved

598Amostly conserved

607Tmostly conserved

622Gvariable

628Avariable

640Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTCGGAATTTGATCTGGAATAGTTGGAACTTCTTTAAGTCTTTTAATTCGTGCTGAATTAGGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.1%

Haplotypes7

BINs3

Most divergent pair9.4%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pima albiplagiatellasame family6.7%Vietteia terstrigellasame family7.0%Pima fosterellasame family7.0%Tephris nigrisparsellasame family7.0%Ceutholopha isidissame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type112 records

Wild obs. + sensor89

Museum / vouchered23

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 39≤1 km 18≤10 km 7>10 km 6

70 georeferenced · 19 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	12
Washington, US	8
Florida Museum of Natural History, McGuire Center for Lepidoptera and Biodiversitylocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

4 institutions · 23 of 23 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Atheloca subrufella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

Palm Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 20.2–27.2

Seasonal swing summer↔winter10.8 °C

Max temp (day)30.7 °C 22.0–31.9

Min temp (night)21.0 °C 16.8–23.2

Precipitation110 mm/mo 67.8–238

Air humidity59.4 % 56.6–61.6

Moisture balance58.5 mm/mo

Vapour deficit1,348 Pa 967–1,389

Wind speed2.70 m/s

Cloud cover31.7 % 30.0–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)