Athelia rolfsii

(Curzi) C.C.Tu & Kimbr. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Atheliales/Atheliaceae/Athelia

At a glance

Occurrence records916

Data sources12

Biological traits0

DNA specimens157

eDNA detections674

Sources12 archives

Databases and archives Athelia rolfsii's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility902 records↗

OBISOcean Biodiversity Information System14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI674 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics157 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF · OBIS916 records

Environmental DNA3 datasets · 7 countries674 detections

DNA & barcodingBOLD · NCBI157 specimens

Genome at a glanceGoaT · NCBI≈72 Mbp

01Narrative

Athelia rolfsii is a corticioid fungus in the family Atheliaceae. It is a facultative plant pathogen and is the causal agent of "southern blight" disease in crops.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition24 compounds

Compounds documented for Athelia rolfsii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones8

Dammarane and Protostane triterpenoids $ Lupane triterpenoids2

Stigmastane steroids1

Aminoacids1

Cholestane steroids1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2S,5R,6R,7R,11S,14R,15R,18R,20S)-20-hydroxy-11,14,15,19,19-pentamethyl-7-prop-1-en-2-yl-8,21-dioxahexacyclo[18.2.2.01,18.02,15.05,14.06,11]tetracosan-9-one	present	NPASS
(3R,8R,9R,10S,13R,14R,17R)-17-[(Z,2S,5S)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5,6-dimethylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
1,8-Dihydroxy-3-(hydroxymethyl)-6-methylanthracene-9,10-dione	present	NPASS
3-Ethynylserine	present	LOTUS
BTCAEOLDEYPGGE-ZBGCTSDRSA-N	present	NPASS
Citreorosein	present	NPASS
Emodic Acid	present	NPASS

05DNA & barcoding157 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Athelia rolfsii has left across the world's sequence archives.

At a glance

DNA specimens157

Marker genes1

GenBank sequences10

eDNA detections674

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPZ295574.1 ↗203 bpSri Lanka · 2024

ACGT

TTGACTGGGTTGACTCGGATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA …

Agroathelia rolfsii isolate SR1 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Athelia rolfsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈72 332 728 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Athelia rolfsii0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.1% BUSCO

08Occurrence & distribution

Record type916 records

Wild obs. + sensor7

Museum / vouchered901

Cultivated / captive8

Range

Area of Occupancy AOO1 644 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 50 m · max 50 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 4 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 1

6 georeferenced · 895 without coordinates

Open the institutions mapphysical evidence901

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	150
Auckland, NZ	115
FLASlocation not on record	4
Odawara, JP	2
Kensington, AU	2
MeiseBGlocation not on record	2
Karlsruhe, DE	2
LDlocation not on record	2
The Maharaja Sayajirao University of Barodalocation not on record	1
Brisbane, AU	1

10 institutions · 281 of 901 vouchered records shown · 579 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA674 detections

Where the DNA of Athelia rolfsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found674

Studies independent surveys3

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 674 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature22.0 °C 13.0–28.0

pH5.70 3.30–9.40

Conductivity44.0 µS/cm 10.0–79,100

Organic carbon1.64 % 0.06–5.93

Water content5.42 % 0.363–91.6

Nitrate-N4.00 mg/kg 0.5–209

Phosphorus7.00 mg/kg 2.00–230

Clay14.9 % 0.95–70.0

Sand73.8 % 1.00–98.1

Depth0 m 0–1.02

MarineSoilKandosolTenosolsChromosolsDermosolSodosolRudosol

500 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 9.10–26.8

Seasonal swing summer↔winter10.9 °C

Max temp (day)21.2 °C 13.5–31.9

Min temp (night)12.8 °C 4.90–22.6

Precipitation55.4 mm/mo 6.60–134

Air humidity57.4 % 46.0–64.7

Moisture balance-52.5 mm/mo -134–263

Vapour deficit802 Pa 428–1,643

Wind speed3.10 m/s 2.00–5.70

Cloud cover20.9 % 8.00–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 546 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)