Athalia scutellariae

Cameron, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Athalia

At a glance

Occurrence records488

Data sources7

Biological traits0

DNA specimens30

eDNA detections42

Sources7 archives

Databases and archives Athalia scutellariae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF488 records

Environmental DNA3 datasets · 8 countries42 detections

DNA & barcodingBOLD30 specimens

01Narrative

Athalia scutellariae is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Athalia scutellariae has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections42

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 98 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Cmostly conserved

4Amostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

14Amostly conserved

15Tmostly conserved

17Amostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Gvariable

23Tmostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

37Amostly conserved

38Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

45Tmostly conserved

48Cmostly conserved

50Tmostly conserved

51Tmostly conserved

54Gmostly conserved

58Amostly conserved

61Tmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Cmostly conserved

75Tmostly conserved

76Amostly conserved

77Amostly conserved

78Gmostly conserved

79Tmostly conserved

80Tmostly conserved

82Amostly conserved

84Cmostly conserved

85Tmostly conserved

86Amostly conserved

87Amostly conserved

88Tmostly conserved

89Tmostly conserved

90Cmostly conserved

92Amostly conserved

94Amostly conserved

96Tmostly conserved

97Tmostly conserved

101Amostly conserved

103Tmostly conserved

110Amostly conserved

115Tmostly conserved

119Amostly conserved

120Cmostly conserved

121Tmostly conserved

125Amostly conserved

127Tmostly conserved

130Amostly conserved

131Gmostly conserved

133Tmostly conserved

139Amostly conserved

154Cmostly conserved

157Tmostly conserved

163Amostly conserved

178Cmostly conserved

184Amostly conserved

190Tmostly conserved

200Amostly conserved

202Cmostly conserved

220Cmostly conserved

322Tmostly conserved

386Cmostly conserved

397Cmostly conserved

583Gmostly conserved

TACACTATACTTTATTATTGGGTTTTGATCAGGAATAATTGGATTATCATTAAGAATAATTATTCGAATAGAACTAAGTTCAACTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes4

BIN1

Most divergent pair15.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Athalia cornubiaesame genus13.2%Athalia libertasame genus13.4%Athalia rosaesame genus14.0%Athalia bicolorsame genus15.0%Athalia ancillasame genus15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type488 records

Wild obs. + sensor321

Museum / vouchered167

Range

Area of Occupancy AOO1 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 156≤1 km 61≤10 km 66>10 km 2

285 georeferenced · 36 without coordinates

Open the mapobservation + sensor321

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 78≤1 km 5≤10 km 36>10 km 1

120 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	49
Helsinki, FI	31
BioFokuslocation not on record	13
ZSMlocation not on record	11
Institute of Zoology Slovak Academy of Scienceslocation not on record	5
Stockholm, SE	4
Gothenburg, SE	4
Bavarian State Collection of Zoologylocation not on record	4
NEFlocation not on record	3
DFFW2018location not on record	3
Tilburg, NL	3
SLU Artdatabankenlocation not on record	3
Metsähallituslocation not on record	2
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	2
DFlocation not on record	1
Oulu, FI	1
Biology Centre of the Czech Academy of Sciences, Institute of Entomologylocation not on record	1

18 institutions · 142 of 167 vouchered records shown · 25 without an institution code

09Environmental DNA42 detections

Where the DNA of Athalia scutellariae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys3

Countries8

Verifiable raw sequence linked18

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 13.4–18.5

Seasonal swing summer↔winter19.2 °C

Max temp (day)19.1 °C 17.6–22.9

Min temp (night)11.2 °C 9.60–13.6

Precipitation76.2 mm/mo 63.0–92.5

Air humidity58.3 % 57.6–62.1

Moisture balance-40.3 mm/mo -54.3–-14.8

Vapour deficit730 Pa 610–890

Wind speed2.80 m/s 2.30–4.20

Cloud cover43.4 % 32.2–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)