Atethmia centrago

(Haworth, 1809) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Atethmia

At a glance

Occurrence records70 870

Data sources9

Biological traits2

DNA specimens34

eDNA detections36

Sources9 archives

Databases and archives Atethmia centrago's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 870 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF70 870 records

Environmental DNA1 datasets · 11 countries36 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈927 Mbp

01Narrative

Atethmia centrago, the centre-barred sallow, is a moth of the family Noctuidae. The species was first described by Adrian Hardy Haworth in 1809. It is found in Europe except Scandinavia and Italy; also in Asia Minor, Armenia, Syria and Palestine. Illustration from John Curtis's British Entomology Volume 5

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atethmia centrago has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections36

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

34Amostly conserved

40Gmostly conserved

103Tmostly conserved

181Gmostly conserved

202Gmostly conserved

217Amostly conserved

292Tmostly conserved

328Gmostly conserved

334Amostly conserved

370Gvariable

409Gmostly conserved

451Cmostly conserved

583Gmostly conserved

592Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTGGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes9

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Orthomoia bloomfieldisame family7.3%Maraschia grisescenssame family7.5%Rhiza commodasame family7.5%Polymixis atossasame family7.5%Atethmia ambustasame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Atethmia centrago carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈926 639 817 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atethmia centrago0.93 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.1% BUSCO

08Occurrence & distribution

Record type70 870 records

Wild obs. + sensor67 597

Museum / vouchered2 887

Other386

Origin

Native1 326

Range

Area of Occupancy AOO41 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 7 694≤1 km 1 213≤10 km 56 623>10 km 79

65 609 georeferenced · 1 988 without coordinates

Open the mapobservation + sensor67 597

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 1 095≤1 km 460≤10 km 1 209>10 km 33

2 797 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence2 887

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	1 633
Zürich, CH	189
Bern, CH	115
Geneva, CH	111
Provincia di Livornolocation not on record	61
Archäologie und Museum Baselland - Museum.BLlocation not on record	52
Naturama Aargaulocation not on record	40
SFRAlocation not on record	34
Musee d'Histoire Naturallelocation not on record	29
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	29
Natural History Museum Rotterdamlocation not on record	23
Nijmegen, NL	22
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	20
Paro, BT	19
Podgorica, ME	19
UMUlocation not on record	18
Winterthur, CH	14
Fribourg, CH	12
CBDClocation not on record	10
Frauenfeld, CH	10
John May Museum of Natural Historylocation not on record	9
Sion, CH	9
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
Philadelphia, US	8
Muzeum Górnośląskie w Bytomiulocation not on record	6
Naturmuseum St. Gallenlocation not on record	6
Radicondoli, IT	6
SLU Artdatabankenlocation not on record	5
MZLUlocation not on record	5
Banyoles, ES	4
ZSMlocation not on record	4
Helsinki, FI	3
Dhaka, BD	3
South Kensington, GB	2
NHMOlocation not on record	2
Research Collection of Bernard Dardennelocation not on record	1
EGBlocation not on record	1
DABUHlocation not on record	1

38 institutions · 2 543 of 2 887 vouchered records shown · 344 without an institution code

09Environmental DNA36 detections

Where the DNA of Atethmia centrago was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map11 countries0

Laguna

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 11.1–16.9

Seasonal swing summer↔winter16.7 °C

Max temp (day)18.5 °C 15.0–21.4

Min temp (night)10.4 °C 6.70–12.9

Precipitation67.6 mm/mo 52.3–106

Air humidity60.9 % 56.0–63.9

Moisture balance-12.4 mm/mo -45.9–29.7

Vapour deficit647 Pa 486–794

Wind speed3.40 m/s 2.20–4.20

Cloud cover40.3 % 35.2–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atethmia centrago

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type70 870 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type70 870 records