Atergatis roseus

(Rüppell, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Xanthidae/Atergatis

At a glance

Occurrence records44

Data sources8

Biological traits4

DNA specimens5

eDNA detections1

Sources8 archives

Databases and archives Atergatis roseus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

OBISOcean Biodiversity Information System7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS44 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

Atergatis roseus, the rosy egg crab, is a species of reef crab from the family Xanthidae with a natural range extending from the Red Sea to Fiji. It has colonised the eastern Mediterranean by Lessepsian migration through the Suez Canal. The flesh of this crab, like many other species in the family Xanthidae, is toxic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max3 m

Depth min0 m

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atergatis roseus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)3.0%

Haplotypes1

BINs2

Where individuals differ — all 41 variable positions, in barcode order

45Amostly conserved

54Amostly conserved

66Cmostly conserved

90Cmostly conserved

163Cmostly conserved

178Cmostly conserved

189Tmostly conserved

192Tmostly conserved

195Amostly conserved

201Cmostly conserved

204Cmostly conserved

213Cmostly conserved

225Cmostly conserved

229Cmostly conserved

232Tmostly conserved

237Tmostly conserved

240Gmostly conserved

255Cmostly conserved

264Gmostly conserved

279Amostly conserved

282Amostly conserved

284Tmostly conserved

287Gmostly conserved

290Cmostly conserved

297Gvariable

309Cmostly conserved

323Cmostly conserved

330Tmostly conserved

333Tmostly conserved

357Gmostly conserved

360Cmostly conserved

373Tmostly conserved

394Cmostly conserved

417Amostly conserved

426Tmostly conserved

465Amostly conserved

471Cmostly conserved

505Cmostly conserved

507Gmostly conserved

561Tmostly conserved

576Cmostly conserved

ATAGTAGGCACTTCTCTAAGATTAATCATTCGTGCTGAACTTGGACAACCTGGAACACTCATTGGCAATGATCAAATCTACAATGTAGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atergatis integerrimussame genus9.2%Zosimus aeneussame family11.9%Epiactaea nodulosasame family12.2%Platypodia eydouxisame family13.0%Atergatis floridussame genus13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor35

Museum / vouchered8

Other1

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 11≤1 km 6≤10 km 4>10 km 2

23 georeferenced · 12 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	4
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
Helsinki, FI	1
Frankfurt am Main	1

4 institutions · 8 of 8 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Atergatis roseus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)