Atelanthera perpusilla

Hook.f. & Thomson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Atelanthera

At a glance

Occurrence records13

Data sources6

Biological traits26

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Atelanthera perpusilla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Atelanthera é um género botânico pertencente à família Brassicaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length20 mm

Fruit length max20 mm

Fruit length min20 mm

Fruit width1 mm

Fruit width max1 mm

Fruit width min1 mm

Leaf length12.5 mm

Leaf length max15 mm

Leaf length min10 mm

Leaf width max3 mm

Leaf width min1 mm

Plant height0.04 m

Plant height max0.16 m

Plant height min0.03 m

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formannual

Life spanannual

Raunkiær life formtherophyte

Habitat & environment6

Climatetemperate

Climberself-supporting

Elevation mean2 500 m

Growth formherb

Habitat GIFTstony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atelanthera perpusilla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFM164518.1 ↗262 bpKyrgyzstan

ACGT

TCGAAACCTGTCCAAACAGAACGACCAGCGAACGAACGATCATCACTTTCGGTGGGCCGGTTTCGTAACTGATCCCGTGCCTGCCAATTC …

Atelanthera perpusilla partial ITS1, specimen voucher ALTB:Atelanthera perpusilla

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type13 records

Museum / vouchered9

Other4

Range

Area of Occupancy AOO48 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 3

5 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence9

10Collections & institutions

Institution	Specimens
GMBAlocation not on record	6
Moscow State Universitylocation not on record	1
Uniwersytet Opolskilocation not on record	1

3 institutions · 8 of 9 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Atelanthera perpusilla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.00 °C 4.00–4.00

Seasonal swing summer↔winter26.5 °C

Max temp (day)8.20 °C

Min temp (night)-1.90 °C

Precipitation45.6 mm/mo

Air humidity54.0 %

Moisture balance-22.6 mm/mo

Vapour deficit456 Pa

Wind speed1.50 m/s

Cloud cover30.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)