Atalaya salicifolia

(DC.) Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Atalaya

At a glance

Occurrence records762

Data sources8

Biological traits37

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Atalaya salicifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility762 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF762 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Atalaya salicifolia is a species of tree native to dry rainforests of tropical and subtropical Australia, New Guinea and Malesia. The leaves of smaller trees of this species have a distinct winged rachis, in larger trees the rachis becomes increasingly cylindrical.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length25 mm

Fruit width14.5 mm

Leaf length120 mm

Leaf length max200 mm

Leaf length min80 mm

Leaf mass per area84.66 g/m2

Leaf size6 258 mm²

⚠ sources differ — TRY: 6 258 mm² · AusTraits: 5 545 mm²

Leaf width13.5 mm

Leaf width max30 mm

Leaf width min5 mm

Petiole length3.25 cm

Plant height11 m

Plant height max10 m

Plant height min1 m

Seed length7 mm

Seed mass33.27 mg

Seed width5.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnnnyyn

Life formtree

Life spanperennial

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesamara

Growth formtree

Leaf compoundnesscompound

Leaf shapenarrowly_elliptical oblong obovate

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)11.9 mm²/mg

Wood density725 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atalaya salicifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895746.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGC …

Atalaya salicifolia voucher 129308756 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type762 records

Wild obs. + sensor271

Museum / vouchered277

Other214

Origin

Native16

Range

Area of Occupancy AOO1 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 96≤1 km 16≤10 km 8>10 km 17

137 georeferenced · 134 without coordinates

Open the mapobservation + sensor271

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 54≤1 km 44≤10 km 70>10 km 22

190 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	86
Kensington, AU	40
Smithfield, AU	29
Museo Entomologico de Leonlocation not on record	23
Canberra, AU	23
Mount Annan, AU	15
Palmerston, AU	13
Armidale, AU	10
Kew, GB	5
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Adelaide, AU	2

11 institutions · 248 of 277 vouchered records shown · 29 without an institution code

09Environmental DNA2 detections

Where the DNA of Atalaya salicifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 20.9–20.9

Seasonal swing summer↔winter10.6 °C

Max temp (day)26.1 °C

Min temp (night)16.3 °C

Precipitation76.1 mm/mo

Air humidity56.7 %

Moisture balance-48.0 mm/mo

Vapour deficit1,085 Pa

Wind speed2.80 m/s

Cloud cover26.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)