Atalaya multiflora

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Atalaya

At a glance

Occurrence records218

Data sources8

Biological traits29

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Atalaya multiflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF218 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Atalaya multiflora, known as the broad leaved whitewood, is a rare and endangered rainforest tree of the soapberry family native to eastern Australia. The habitat is in the drier rainforest areas, often on rocky slopes of basalt. However, it also is seen on sub-tropical lowland rainforest growing on alluvial soils. It was described by prolific botanist George Bentham in his Flora Australiensis in 1863, and was given the specific name multiflora because of the numerous flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Fruit length27.5 mm

Fruit width14 mm

Leaf length82.5 mm

Leaf length max240 mm

Leaf length min70 mm

Leaf width40 mm

Leaf width max40 mm

Leaf width min15 mm

Petiole length2.75 cm

Plant height25 m

Seed length5.5 mm

Seed width4.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timeynnnnnnnnyyy

Life formtree

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesamara

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical oblong obovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atalaya multiflora has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896164.1 ↗553 bpAustralia

ACGT

AAGTGTCGGATTCAACGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGC …

Atalaya multiflora voucher 1076420315 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type218 records

Wild obs. + sensor56

Museum / vouchered113

Other49

Origin

Native17

Introduced2

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 37≤1 km 2≤10 km 2

41 georeferenced · 15 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 27≤1 km 4≤10 km 47>10 km 13

91 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	51
Mount Annan, AU	17
Museo Entomologico de Leonlocation not on record	16
Armidale, AU	6
Canberra, AU	6
Smithfield, AU	4
Kew, GB	2
CMULlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Palmerston, AU	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

11 institutions · 106 of 113 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Atalaya multiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.3 °C 20.3–20.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)25.6 °C

Min temp (night)15.8 °C

Precipitation82.2 mm/mo

Air humidity57.7 %

Moisture balance-39.7 mm/mo

Vapour deficit1,027 Pa

Wind speed2.70 m/s

Cloud cover25.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)