Atalaya hemiglauca

F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Atalaya

At a glance

Occurrence records7 427

Data sources8

Biological traits44

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Atalaya hemiglauca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF7 427 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Atalaya hemiglauca, commonly known as whitewood or cattle bush, is a species of plant in the soapberry (Sapindaceae) family. It is native to northern and inland Australia where it occurs from Western Australia through the Northern Territory and South Australia to Queensland and northern New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology19

Fruit length30 mm

Leaf length104 mm

Leaf length max200 mm

Leaf length min80 mm

Leaf mass173 mg

Leaf mass per area155 g/m2

Leaf size1 171 mm²

Leaf width9.29 mm

Leaf width max15 mm

Leaf width min3 mm

Petiole length2.15 cm

Plant height5.5 m

⚠ sources differ — AusTraits: 5.5 m · TRY: 5 m

Plant height max10 m

Plant height min1 m

Seed length5.5 mm

Seed mass85.5 mg

⚠ sources differ — TRY: 85.5 mg · AusTraits: 66.7 mg · GIFT: 87.79 mg

Seed mass max143 mg

Seed mass min61.08 mg

Seed width4.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnnyynnn

Life formtree

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesamara

Growth formtree

Leaf compoundnesscompound

Leaf shapefalcate linear narrowly_elliptical obovate

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry4

Leaf n14.53 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.47 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atalaya hemiglauca has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895582.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGC …

Atalaya hemiglauca voucher 129307930 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type7 427 records

Wild obs. + sensor4 997

Museum / vouchered1 307

Cultivated / captive3

Other1 120

Origin

Native405

Range

Area of Occupancy AOO20 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 033≤1 km 134≤10 km 92>10 km 23

3 282 georeferenced · 1 715 without coordinates

Open the mapobservation + sensor4 997

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 201≤1 km 184≤10 km 572>10 km 180

1 137 georeferenced · 170 without coordinates

Open the institutions mapphysical evidence1 307

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	256
Canberra, AU	187
Palmerston, AU	177
Museo Entomologico de Leonlocation not on record	169
Mount Annan, AU	142
Adelaide, AU	122
Kensington, AU	82
Armidale, AU	36
Smithfield, AU	32
Kew, GB	14
NSW Dept of Planning, Industry and Environmentlocation not on record	11
BGPAlocation not on record	11
James Cook Townsvillelocation not on record	7
Hobart, AU	4
John T. Waterhouse Herbariumlocation not on record	4
Taipei, TW	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
IPA/SPlocation not on record	1
Guangzhou, CN	1
Minia, EG	1
Miami, US	1
La Trobe Universitylocation not on record	1

22 institutions · 1 261 of 1 307 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Atalaya hemiglauca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 20.4–25.4

Seasonal swing summer↔winter14.2 °C

Max temp (day)28.7 °C 26.2–31.2

Min temp (night)17.2 °C 14.8–19.6

Precipitation46.2 mm/mo 43.3–49.0

Air humidity48.6 % 45.8–51.4

Moisture balance-103 mm/mo -108–-98.9

Vapour deficit1,538 Pa 1,247–1,829

Wind speed3.60 m/s 3.10–4.10

Cloud cover27.9 % 25.7–30.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atalaya hemiglauca

At a glance

Sources8 archives

Size & morphology19

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

Other traits1

At a glance

Record type7 427 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 427 records