Atalantia buxifolia

(Poir.) Oliv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Atalantia

At a glance

Occurrence records1 039

Data sources13

Biological traits12

DNA specimens14

eDNA detections11

Sources13 archives

Databases and archives Atalantia buxifolia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 039 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources12 traits

Chemical compositionLOTUS · NPASS191 compounds

Occurrence & distributionGBIF1 039 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB · GoaT · NCBI328 Mbp

01Narrative

Atalantia buxifolia, synonym Severinia buxifolia, is a species of plant in the family Rutaceae, related to Citrus and Citropsis. Its common names include Chinese box-orange, box orange or boxthorn. It is native to southern China. It produces small black berries that resemble black currants. The fruits are eaten by birds that disperse its seeds. It is an evergreen in the wild.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology1

Plant height2.5 m

⚠ sources differ — GIFT: 2.5 m · TRY: 2 m

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub

Life spanperennial

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: Tree, Shrub

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition191 compounds

Compounds documented for Atalantia buxifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acridone alkaloids36

Limonoids24

Santalane sesquiterpenoids18

Flavan-3-ols15

Simple coumarins11

Documented compounds191 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(+)-Trachelanthamidine	present	NPASS
(-)-Caryophyllene	present	LOTUS
(-)-epi-beta-Santalene	present	LOTUS
(-)-Linalool	present	NPASS
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
(1R,2R,5S,6S,9S,11R,12S,13S,14R,15S)-6-(furan-3-yl)-13,14-dihydroxy-5,12,16,16-tetramethyl-7,10,17-trioxahexacyclo[13.3.3.01,15.02,12.05,11.09,11]henicos-19-ene-8,21-dione	present	LOTUS
(1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene	present	LOTUS
(1S,2R,5S,6S,9S,11R,12S,13S,14R,15R)-6-(furan-3-yl)-13,14-dihydroxy-5,12,16,16-tetramethyl-7,10,17-trioxahexacyclo[13.3.3.01,15.02,12.05,11.09,11]henicos-19-ene-8,21-dione	present	LOTUS
(1S,2R,5S,6S,9S,11R,12S,13S,15R)-6-(furan-3-yl)-13-hydroxy-5,12,16,16-tetramethyl-7,10,17-trioxahexacyclo[13.3.3.01,15.02,12.05,11.09,11]henicos-19-ene-8,14,21-trione	present	LOTUS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atalantia buxifolia has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes5

GenBank sequences10

eDNA detections11

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV368998.1 ↗471 bpChina · 2024

ACGT

TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGATAGGCCGAGGGCACGTCTGCCTGGGTGTC …

Atalantia buxifolia voucher MC69 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Atalantia buxifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size327 630 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Atalantia buxifolia0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–362n range18median18mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Guerra, M., K. G. B. d. Santos, A. E. B. e. Silva & F. Ehrendorfer. 2000. Heterochromatin banding patterns in Rutaceae--Aurantioideae---a case of parallel chromosomal evolution. Amer. J. Bot. 87(5): 735–747.

CCDB · ipcn-api-dl — Guerra, M. d. S. 1984. New chromosome numbers in Rutaceae. Pl. Syst. Evol. 146: 13–30.

CCDB · ipcn-api-dl — Guerra, M. d. S. & F. B. G. d. Souza. 1984. Tamanho cromoss@6omico e número básico na tribo Aurantieae (Rutaceae). Ci. & Cult. (Sao Paulo) 36: 868.

CCDB · book-fedorov — Negodi 1937

CCDB · book-fedorov — Longley 1925

CCDB · kew — Kayim M, Koç NK, Rokka VM. 1998. Variation of the nuclear DNA content of species of subtribe Citrinae (Rutaceae). Hortscience 33: 1247-1250.

2n 361×CCDB · eflora

CCDB · eflora

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Agarwal, P. K. 1988. Pachytene morphology of Severinia buxifolia (Ten.). CIS Chromosome Inform. Serv. 44: 24–26.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.974 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98% BUSCO

08Occurrence & distribution

Record type1 039 records

Wild obs. + sensor859

Museum / vouchered180

Origin

Introduced8

Range

Area of Occupancy AOO1 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 497≤1 km 82≤10 km 17>10 km 20

616 georeferenced · 243 without coordinates

Open the mapobservation + sensor859

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 178 without coordinates

Open the institutions mapphysical evidence180

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	53
Beijing, CN	26
Guilin, CN	25
Guangzhou, CN	18
Nanjing, CN	7
Kunming, CN	6
Bronx, US	6
Chengdu, CN	6
Taipei, TW	5
中国林业科学研究院热带林业科学研究所植物标本室location not on record	4
Nanchong, CN	3
Hangzhou, CN	2
University of Stellenboschlocation not on record	2
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	2
Changsha, CN	2
Xiamen, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Jinghong, CN	1
Cincinnati, US	1
Minia, EG	1
Taipei, TW	1
Shenzhen, CN	1
Alexandria Universitylocation not on record	1
Guiyang, CN	1
Shanghai, CN	1
Yunnan Universitylocation not on record	1

26 institutions · 178 of 180 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Atalantia buxifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

By the coast

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 9.90–24.9

Seasonal swing summer↔winter11.7 °C

Max temp (day)22.0 °C 12.0–26.0

Min temp (night)17.2 °C 5.90–23.3

Precipitation344 mm/mo 91.8–502

Air humidity64.9 % 58.3–72.5

Moisture balance263 mm/mo -11.0–371

Vapour deficit865 Pa 515–966

Wind speed4.30 m/s 3.20–4.40

Cloud cover44.6 % 34.3–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atalantia buxifolia

At a glance

Sources13 archives

Size & morphology1

Life cycle & reproduction4

Habitat & environment5

Physiology & chemistry2

Compound class profile5 classes

Documented compounds191 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 039 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 039 records