Asystasia gangetica
(L.) T.Anderson · speciesAt a glance
Occurrence records13 508
Data sources13
Biological traits41
DNA specimens17
eDNA detections11
Sources13 archives
Databases and archives Asystasia gangetica's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 508 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS19 compounds
Occurrence & distributionGBIF13 508 records
Environmental DNA1 datasets · 5 countries11 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB · GIFT2n = 26
01Narrative
Asystasia gangetica is a species of plant in the family Acanthaceae. It is commonly known as the Chinese violet, coromandelPlants of Hawaii: Asystasia gangetica: http://www.hear.org/starr/images/species/?q=asystasia+gangetica&o=plants, retrieved 28 July 2010 or creeping foxglove.South African National Biodiversity Institute: Asystasia gangetica: http://www.plantzafrica.com/plantab/asystasiagan.htm, retrieved 28 July 2010 In South Africa this plant may simply be called asystasia.Pooley, E. (1998). A Field Guide to Wild Flowers; KwaZulu-Natal and the Eastern Region. . From Hyderabad, India
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology12
Fruit length2.5 mm
⚠ sources differ — AusTraits: 2.5 mm · GIFT: 30 mm
Fruit length max30 mm
Fruit length min20 mm
Leaf length5.5 mm
⚠ sources differ — AusTraits: 5.5 mm · GIFT: 75 mm
Leaf length max130 mm
Leaf length min25 mm
Leaf width max40 mm
Leaf width min10 mm
Plant height1.1 m
⚠ sources differ — GIFT: 1.1 m · AusTraits: 1 m
Plant height max2 m
Plant height min0.305 m
Seed mass7.32 mg
Life cycle & reproduction10
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeself
Flower colourblue
Life formscrambling annual or subshrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFT-
Leaf shapeovate
Succulenceno
Woodinessnon-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)20.72 mm²/mg
Other traits2
Seeds per fruit1-10
Shoot orientationprostrate
03Chemical composition19 compounds
Compounds documented for Asystasia gangetica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Iridoids monoterpenoids5
Flavones5
Megastigmanes3
Phenylethanoids2
Cinnamic acids and derivatives $ Phenylethanoids1
Documented compounds19 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,5R,8S)-8-hydroxy-1,5-dimethyl-8-[(3R)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-6-oxabicyclo[3.2.1]octan-3-one | present | LOTUS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[2-(4-hydroxyphenyl)ethoxy]oxane-3,4,5-triol | present | LOTUS | |
| (2R,3S,4S,5S,6R)-2-[[(1S,4aS,5R,7S,7aS)-5,7-dihydroxy-7-methyl-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[(3R)-oct-1-en-3-yl]oxyoxan-3-yl]oxy-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-[(2S,3R,4S,5R,6R)-3,5-dihydroxy-2-[[(1S,2S,4S,5S,6R,10S)-5-hydroxy-2-(hydroxymethyl)-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-10-yl]oxy]-6-(hydroxymethyl)oxan-4-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (6R,9S)-Roseoside | present | LOTUS | |
| 2-[(5,7-dihydroxy-7-methyl-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-1-yl)oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| 6-Deoxycatalpol | present | LOTUS | |
| 6S,9R-Roseoside | present | LOTUS | |
| 7-[(2S,3R,4S,5S,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(4-hydroxyphenyl)chromen-4-one | present | LOTUS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asystasia gangetica has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes5
GenBank sequences10
eDNA detections11
Countries5
The DNA barcodea real sequence read deposited for this species
CCGCCCCCCCGCTCGTGCCCCGTCCGCGGTGCGCTCGGGCGGGGGGACGGCGGCGCCTCACCTACGTCGAAACGACTCTCGGCAACGGAT …
Asystasia gangetica voucher 2024MSLS0021 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★trnL-F★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Asystasia gangetica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidy2× diploid · measured
Chromosome records26–522n range28median26mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2610×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +1
CCDB · ipcn-api-dl — Gadella, T. W. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 595–596.
CCDB · ipcn-api-dl — Ugborogho, R. E. & O. A. Adetula. 1988. The biology of the Asystasia gangetica complex (Acanthaceae) in Lagos State, Nigeria. Feddes Repert. 99: 507–517.
CCDB · ipcn-api-dl — Gadella, T. W. J. 1977d. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · ipcn-api-dl — Pandit, M. K. 2006. Polyploidy in invasive plant species of Singapore. Bot. J. Linn. Soc. 151: 395–403.
CCDB · book-indian_vol1 — Gadella, T.W.J. 1977
CCDB · book-fedorov — Mangenot s., Mangenot G. 1957
CCDB · book-fedorov — Narayanan 1951b
CCDB · book-fedorov — Mangenot S., Mangenot G. 1957, 1962
CCDB · book-fedorov — Mangenot S., Mangenot G. 1962
GIFT · GIFT (floras)
2n 526×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · Cave1956 +1
CCDB · book-indian_vol1 — Grant, W.F. 1955 ; Ellis, J.L. 1962, Kaur, J. 1965b
CCDB · book-fedorov — Grant W. F. 1955
CCDB · book-fedorov — Ellis 1962
CCDB · book-fedorov — Kaur 1965b
CCDB · Cave1956 — Grant
GIFT · GIFT (floras)
2n 504×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-indian_vol1 +1
CCDB · ipcn-api-dl — Sarkar, A. K., M. CHAKRABORTY, N. C. SAHA, S. K. DAS & D. HAZRA. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn66 — De 1966
CCDB · book-indian_vol1 — De, A. 1966a; Sarkar, A.K., Chakra- verty, M. et al. 1978
GIFT · GIFT (floras)
2n 283×CCDB · ipcn-api-dl · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Subramanian, D. & T. Govindarajan. 1980. Cytotaxonomy of some species of Acanthaceae. J. Cytol. Genet. 15: 90–92.
CCDB · ipcn-api-dl — Govindarajan, T. & D. Subramanian. 1983. Karyomorphological studies in south Indian Acanthaceae. Cytologia 48: 491–504.
GIFT · GIFT (floras)
2n 251×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Narayanan, C.R. 195lb; Mangenot, S. & Mangenot, G. 1957, 1962
2n 441×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 481×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 265×CCDB · book-ipcn65 · CCDB · ipcn-api-dl
CCDB · book-ipcn65 — Kaur 1965b
CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.
CCDB · ipcn-api-dl — Valsala Deri, G. & P. M. Mathew. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 773.
CCDB · ipcn-api-dl — Saggoo, M. I. & S. S. Bir. 1986. Meiotic studies in certain members of family Acanthaceae from south India. J. Indian Bot. Soc. 65: 310–315.
CCDB · ipcn-api-dl — Daniel, T. F. 2000. Additional chromosome numbers of American Acanthaceae. Syst. Bot. 25(1): 15–25.
n 131×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Daniel, T. F., K. Balkwill & M. J. Balkwill. 2000. Chromosome numbers of South African Acanthaceae. Proc. Calif. Acad. Sci. 52(12): 143–158.
n 251×CCDB · book-ipcn66
CCDB · book-ipcn66 — De 1966
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type13 508 records
Wild obs. + sensor11 509
Museum / vouchered1 835
Other164
Origin
Native1
Introduced48
Range
Area of Occupancy AOO19 732 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 3 798≤1 km 636≤10 km 601>10 km 277
5 312 georeferenced · 6 197 without coordinates
Open the mapobservation + sensor11 509
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 29≤1 km 42≤10 km 50>10 km 17
138 georeferenced · 1 697 without coordinates
Open the institutions mapphysical evidence1 835
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions63 of 177 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 162 |
| Kew, GB | 149 |
| Forest Herbarium Ibadan (FHI)location not on record | 127 |
| University of Stellenboschlocation not on record | 57 |
| WAGlocation not on record | 49 |
| Yaoundé, CM | 45 |
| LBVlocation not on record | 34 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 28 |
| LSF/FSA/UAClocation not on record | 28 |
| Herbier National du Gabonlocation not on record | 27 |
| HNBlocation not on record | 26 |
| Adam Mickiewicz University in Poznańlocation not on record | 26 |
| Bronx, US | 25 |
| Tampa, US | 23 |
| National Biodiversity Institute, Costa Ricalocation not on record | 21 |
| Plocation not on record | 20 |
| Uppsala, SE | 20 |
| Palmerston, AU | 16 |
| Honolulu, US | 16 |
| BISHlocation not on record | 15 |
| MAlocation not on record | 15 |
| St. Augustine, TT | 15 |
| Pondicherry, IN | 14 |
| Paris, FR | 14 |
| CASlocation not on record | 13 |
| TAFORI-LSRClocation not on record | 12 |
| Miami, US | 12 |
| IFAN Ch. A. Dioplocation not on record | 12 |
| Université du Lomélocation not on record | 10 |
| MeiseBGlocation not on record | 10 |
| Adelaide, AU | 9 |
| Canberra, AU | 9 |
| Kunming, CN | 9 |
| Altos de Pipe, VE | 8 |
| Universidad de Antioquia (UdeA)location not on record | 8 |
| Pretoria, ZA | 8 |
| Xiamen, CN | 8 |
| Baroda, IN | 8 |
| Antiguo Cuscatlán, SV | 7 |
| Stockholm, SE | 7 |
| Beijing, CN | 7 |
| Puerto Ayora, EC | 6 |
| Edinburgh, GB | 6 |
| Auckland, NZ | 6 |
| Chongqing Museumlocation not on record | 6 |
| Universidad Industrial de Santander (UIS)location not on record | 6 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 6 |
| EL PASO, US | 6 |
| Chaguaramas, TT | 6 |
| BRLUlocation not on record | 6 |
| National Herbarium of São Tomé and Principelocation not on record | 6 |
| LDlocation not on record | 6 |
| Leiden University Medical Centerlocation not on record | 6 |
| Masindi, UG | 6 |
| Frankfurt am Main | 5 |
| Museu Paraense Emílio Goeldilocation not on record | 5 |
| Elocation not on record | 5 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 5 |
| San José, CR | 5 |
| Moscow State Universitylocation not on record | 5 |
| Laboratorio de Ictiologialocation not on record | 5 |
| Brussels, BE | 5 |
| CNF-UFHBlocation not on record | 5 |
| Chicago, US | 5 |
| Claremont, US | 5 |
| UNTNRlocation not on record | 4 |
| UFRPElocation not on record | 4 |
| Berlin, DE | 4 |
| Glocation not on record | 4 |
| Universidad de Nariño (UdeNar)location not on record | 4 |
| CJBGlocation not on record | 4 |
| León, NI | 4 |
| Clocation not on record | 4 |
| Feira de Santana, BR | 3 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 3 |
| Université National du Béninlocation not on record | 3 |
| Kensington, AU | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| UFERSAlocation not on record | 3 |
| UFBAlocation not on record | 3 |
| HAWlocation not on record | 3 |
| Universidad del Quindío (UniQuindío)location not on record | 3 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Museum of Zoologylocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Njala Universitylocation not on record | 2 |
| University of Hawaii at Manoalocation not on record | 2 |
| IPHAMETRAlocation not on record | 2 |
| Bloomington, US | 2 |
| Kagoshima, JP | 2 |
| Christchurch, NZ | 2 |
| INBIOlocation not on record | 2 |
| EAlocation not on record | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Smithfield, AU | 2 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Toronto, CA | 2 |
| Edmonton, CA | 2 |
| Gump Stationlocation not on record | 2 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 2 |
| OTSlocation not on record | 2 |
| Wuzhou, CN | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| National Natural History Collectionslocation not on record | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| HUAlocation not on record | 1 |
| Armidale, AU | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| University of Oxfordlocation not on record | 1 |
| Wlocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Addis Ababa, ET | 1 |
| IFANlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 1 |
| LISClocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Whitewater, US | 1 |
| IPA/SPlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| UnBlocation not on record | 1 |
| Salvador, BR | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Santiago de Cali, CO | 1 |
| CMULlocation not on record | 1 |
| University of Calabar/Department of Plant and Ecological Studies Herbariumlocation not on record | 1 |
| Teresina, BR | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Ilhéus, BR | 1 |
| Mount Annan, AU | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Brisbane, AU | 1 |
| Vancouver, CA | 1 |
| Brasília, BR | 1 |
| Campo Mourão, BR | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Bangkok, TH | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| BAYLUlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Dresden, DE | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Haramaya Universitylocation not on record | 1 |
| Provo, US | 1 |
| Palmerston North, NZ | 1 |
| University of Johannesburglocation not on record | 1 |
| UEPAlocation not on record | 1 |
| UFPElocation not on record | 1 |
| IECOSlocation not on record | 1 |
| HUENFlocation not on record | 1 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 1 |
| Fortaleza, BR | 1 |
| Maringá, BR | 1 |
| UTFPR-SLlocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| DSMlocation not on record | 1 |
177 institutions · 1 450 of 1 835 vouchered records shown · 385 without an institution code
09Environmental DNA11 detections
Where the DNA of Asystasia gangetica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.6 °C 21.9–26.1
Seasonal swing summer↔winter3.30 °C
Max temp (day)28.1 °C 23.2–29.5
Min temp (night)21.7 °C 16.6–22.6
Precipitation87.8 mm/mo 16.6–269
Air humidity58.1 % 52.0–68.1
Moisture balance-76.9 mm/mo
Vapour deficit1,145 Pa 1,039–1,306
Wind speed2.60 m/s
Cloud cover40.1 % 15.0–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.