Astropyga pulvinata

(Lamarck, 1816) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Diadematoida/Diadematidae/Astropyga

At a glance

Occurrence records288

Data sources9

Biological traits4

DNA specimens8

eDNA detections8

Sources9 archives

Databases and archives Astropyga pulvinata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility250 records↗

OBISOcean Biodiversity Information System38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS288 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Astropyga pulvinata is a species of sea urchins of the family Diadematidae. Their armour is covered with spines. Astropyga pulvinata was first scientifically described in 1816 by Jean-Baptiste de Lamarck.Kroh, A. (2010). Astropyga pulvinata (Jean-Baptiste de Lamarck, 1816). In: Kroh, A. & Mooi, R. (2010) World Echinoidea Database. at the World Register of Marine Species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max37 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astropyga pulvinata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

22Avariable

40Avariable

59Amostly conserved

61Tmostly conserved

235Tmostly conserved

268Amostly conserved

AACTCTTTATTTAATCTTTGGAGCCTGAGCCGGAATGGTAGGAACTGCTATGAGCGTGATTATTCGAGCCGAACTAGCTCAACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinothrix diademasame family15.8%Echinothrix calamarissame family16.3%Caenopedina porphyrogigassame order17.0%Centrostephanus longispinussame family17.5%Caenopedina novaezealandiaesame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type288 records

Wild obs. + sensor177

Museum / vouchered111

Range

Area of Occupancy AOO600 km²

Depth

0–200 m sunlit25

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18 m · max 51.2 m · 25 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 54≤1 km 51≤10 km 18>10 km 10

133 georeferenced · 44 without coordinates

Open the mapobservation + sensor177

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 37≤1 km 9≤10 km 10>10 km 20

76 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	24
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	14
CASlocation not on record	13
Cambridge, US	12
Los Angeles, US	10
University of California Museum of Paleontologylocation not on record	2
Stockholm, SE	2
Paris, FR	1
University of California San Diegolocation not on record	1
Universidad del Valle (UniValle)location not on record	1
Chicago, US	1

11 institutions · 81 of 111 vouchered records shown · 4 without an institution code

09Environmental DNA8 detections

Where the DNA of Astropyga pulvinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.4–25.7

Seasonal swing summer↔winter1.40 °C

Max temp (day)27.2 °C 27.2–27.9

Min temp (night)24.7 °C 23.4–24.7

Precipitation182 mm/mo 182–228

Air humidity68.3 % 68.3–68.5

Moisture balance5.40 mm/mo 5.40–62.1

Vapour deficit1,045 Pa 1,019–1,045

Wind speed5.00 m/s 4.60–5.00

Cloud cover34.4 % 31.4–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)