Astrophytum myriostigma

Lem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Astrophytum

At a glance

Occurrence records345

Data sources11

Biological traits5

DNA specimens6

eDNA detections6

Sources11 archives

Databases and archives Astrophytum myriostigma's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility345 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF345 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Astrophytum myriostigma, the bishop's cap cactus, bishop's hat or bishop's miter cactus, is a species of cactus native to the highlands of northeastern and central Mexico. Synonyms include Echinocactus myriostigma, Astrophytum prismaticum, A. columnare, A. tulense, and A. nuda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Habitat & environment2

Climatedesert or dry shrubland

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrophytum myriostigma has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMK449092.1 ↗539 bp

ACGT

GGTGTTAAAGAATACAAATTTACTTATTATACTCCTGAATATCAACCCCAGGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Astrophytum myriostigma ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Astrophytum myriostigma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Das, A. B., S. Mohanty & P. Das. 2000. Cytophotometric estimation of 4C DNA content and chromosome analysis in four species of Astrophytum Lem. of the family Cactaceae. Cytologia 65: 135–139.

CCDB · book-fedorov — Katagiri 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type345 records

Wild obs. + sensor226

Museum / vouchered106

Cultivated / captive12

Other1

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 2≤1 km 1>10 km 222

225 georeferenced · 1 without coordinates

Open the mapobservation + sensor226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 87≤1 km 2≤10 km 2>10 km 2

93 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence106

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 11

11 georeferenced · 1 without coordinates

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	84
ASUlocation not on record	6
Phoenix, US	5
Durango, MX	2
Austin, US	1
San Francisco, US	1
Mexico City, MX	1
Kew, GB	1
San Diego, US	1
Saint Louis, US	1
Austin, US	1

11 institutions · 104 of 106 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Astrophytum myriostigma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 12.8–15.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.2 °C 18.8–21.7

Min temp (night)8.60 °C 8.30–8.90

Precipitation57.2 mm/mo 39.2–75.1

Air humidity54.1 % 51.6–56.7

Moisture balance-65.8 mm/mo -87.8–-43.8

Vapour deficit809 Pa 748–869

Wind speed4.90 m/s 4.20–5.60

Cloud cover31.1 % 26.7–35.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)