Astronium graveolens
Jacq. · speciesAt a glance
Occurrence records49 272
Data sources10
Biological traits45
DNA specimens11
eDNA detections6
Sources10 archives
Databases and archives Astronium graveolens's data was compiled from.
WikipediaWikimedia Foundation4 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility49 272 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources45 traits
Occurrence & distributionGBIF49 272 records
Environmental DNA1 datasets · 3 countries6 detections
DNA & barcodingBOLD · NCBI11 specimens
01Narrative
Astronium graveolens is a species of flowering tree in the cashew family, Anacardiaceae, that is native to the Yucatán Peninsula in Mexico, Central America, and South America as far south as Bolivia. Common names include glassywood, ronrón (Spanish), and aroeira (Portuguese). This plant is cited in Flora Brasiliensis by Carl Friedrich Philipp von Martius.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology13
Leaf length62.5 mm
Leaf size10 141 mm²
Leaf width24 mm
Plant height35 m
⚠ sources differ — GIFT: 35 m · TRY: 11.38 m
Plant height max40 m
Seed length11.7 mm
Seed length max8.11 mm
Seed length min3 mm
Seed mass28.8 mg
Seed volume30 mm³
Seed volume max30 mm³
Seed volume min30 mm³
Seed width max2.6 mm
Life cycle & reproduction6
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dispersal typeanimal
Life formtree
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Growth formtree
Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry11
Ldmc max488 mg/g
Ldmc min434 mg/g
Leaf C:N ratio17.98 g/g
Leaf c479 mg/g
Leaf dry-matter content (LDMC)418 mg/g
⚠ sources differ — TRY: 418 mg/g · GIFT: 467 mg/g
Leaf n27.09 mg/g
Leaf p1.77 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)13.98 mm²/mg
⚠ sources differ — TRY: 13.98 mm²/mg · GIFT: 27.88 mm²/mg
Wood density808 mg/cm³
Other traits4
Leaf thickness0.011 mm
Seed height max2.6 mm
Sla max23.76 mm²/mg
Sla min9.39 mm²/mg
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astronium graveolens has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes5
GenBank sequences9
eDNA detections6
Countries3
The DNA barcodea real sequence read deposited for this species
TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACCTGTTTTCAAACACCGGGGCTTGCGG …
Astronium graveolens culture STRI:Corteva SJWright RS00101 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL3★rbcLa★ITS2★ITS2
plant barcodefungal barcode
08Occurrence & distribution
Record type49 272 records
Wild obs. + sensor47 272
Museum / vouchered1 886
Cultivated / captive6
Other108
Origin
Native266
Range
Area of Occupancy AOO8 568 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 320≤1 km 28≤10 km 22>10 km 28
398 georeferenced · 46 874 without coordinates
Open the mapobservation + sensor47 272
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy85% within 1 km
≤100 m 323≤1 km 17≤10 km 50>10 km 8
398 georeferenced · 1 488 without coordinates
Open the institutions mapphysical evidence1 886
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 2
2 georeferenced · 4 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions58 of 151 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Empresas Públicas de Medellín E.S.P. (EPM)location not on record | 353 |
| Saint Louis, US | 176 |
| Mexico City, MX | 103 |
| Durango, MX | 98 |
| HUENFlocation not on record | 60 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 56 |
| National Biodiversity Institute, Costa Ricalocation not on record | 53 |
| Bronx, US | 50 |
| Mexico City, MX | 47 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 46 |
| Chapingo, MX | 39 |
| Mexico City, MX | 31 |
| La Paz, BO | 30 |
| Antiguo Cuscatlán, SV | 29 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 28 |
| UFRRJlocation not on record | 27 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 24 |
| Universidad Nacional de Colombia (UNAL)location not on record | 23 |
| Laboratorio de Ictiologialocation not on record | 22 |
| Universidad de Antioquia (UdeA)location not on record | 22 |
| León, NI | 21 |
| Chicago, US | 20 |
| Mérida, MX | 20 |
| USP-IBlocation not on record | 19 |
| Kew, GB | 18 |
| UNICAMPlocation not on record | 18 |
| JBRJlocation not on record | 16 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 16 |
| Berlin, DE | 14 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 14 |
| Tapachula, MX | 13 |
| Tuxtla Gutiérrez, MX | 12 |
| ASUlocation not on record | 12 |
| Autlán de Navarro, MX | 12 |
| San José, CR | 11 |
| Austin, US | 10 |
| MEXUlocation not on record | 10 |
| Seropédica, BR | 9 |
| Feira de Santana, BR | 9 |
| Tuxtla Gutiérrez, MX | 8 |
| UNIVASFlocation not on record | 8 |
| UEMlocation not on record | 8 |
| Universidad del Tolima (UT)location not on record | 8 |
| MAlocation not on record | 7 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| Université de Bordeauxlocation not on record | 7 |
| Guatemala, GT | 6 |
| Riverside, US | 6 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 6 |
| Campo Grande, BR | 5 |
| UEMAlocation not on record | 5 |
| Altos de Pipe, VE | 5 |
| ESALQlocation not on record | 5 |
| Tampa, US | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| UTFPR-CPlocation not on record | 5 |
| Universidad Nacional de Asunciónlocation not on record | 4 |
| Maringá, BR | 4 |
| UFMGlocation not on record | 4 |
| IAvHlocation not on record | 4 |
| UFVJMlocation not on record | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| Londrina, BR | 4 |
| UFMSlocation not on record | 4 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Montecillo, Texcoco, MX | 3 |
| Ivano-Frankivsk, UA | 3 |
| Campo Mourão, BR | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 3 |
| Fortaleza, BR | 3 |
| Universidad Católica de Oriente (UCO)location not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 3 |
| Loja, EC | 3 |
| BMlocation not on record | 3 |
| Paris, FR | 3 |
| University of Stellenboschlocation not on record | 3 |
| San Francisco, US | 3 |
| Davis, US | 2 |
| Universidade de São Paulolocation not on record | 2 |
| INBIOlocation not on record | 2 |
| Masindi, UG | 2 |
| Anchorage, US | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 2 |
| Universidade Paulistalocation not on record | 2 |
| Universidad de Córdoba (UniCórdoba)location not on record | 2 |
| Escuela Agrícola Panamericanalocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| CASlocation not on record | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| Paleontological Collectionlocation not on record | 2 |
| UFBAlocation not on record | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| UFSCarlocation not on record | 1 |
| Helsinki, FI | 1 |
| HUAlocation not on record | 1 |
| Sucre, BO | 1 |
| Santa Teresa, BR | 1 |
| HEMlocation not on record | 1 |
| Universidad Autónoma de Madridlocation not on record | 1 |
| Phoenix, US | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| UERJlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Miami, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Mérida, MX | 1 |
| SCZlocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Knox Collegelocation not on record | 1 |
| Puebla, MX | 1 |
| PUC-RIOlocation not on record | 1 |
| Mexico City, MX | 1 |
| Clemson, US | 1 |
| San Francisco de Campeche, MX | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Wlocation not on record | 1 |
| OTSlocation not on record | 1 |
| INMAlocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Instituto Nacional de Investigaciones sobre Recursos Bióticoslocation not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| UnBlocation not on record | 1 |
| Richmond, US | 1 |
| CEPLAClocation not on record | 1 |
| Corrientes, AR | 1 |
| IPA/SPlocation not on record | 1 |
| Aarhus, DK | 1 |
| Brasília, BR | 1 |
| St. Paul, US | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| South Kensington, GB | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Salamanca, ES | 1 |
| WTUlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| VALElocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
151 institutions · 1 869 of 1 886 vouchered records shown · 16 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA6 detections
Where the DNA of Astronium graveolens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.7 °C 25.1–25.7
Seasonal swing summer↔winter2.00 °C
Max temp (day)27.7 °C 27.7–28.7
Min temp (night)24.1 °C 22.0–24.1
Precipitation274 mm/mo 95.4–274
Air humidity69.9 % 63.1–69.9
Moisture balance105 mm/mo -35.0–105
Vapour deficit989 Pa 989–1,171
Wind speed2.90 m/s 2.30–3.00
Cloud cover46.2 % 27.0–46.2
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.