Astroloba corrugata

N.L.Mey. & Gideon F.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Astroloba

At a glance

Occurrence records128

Data sources9

Biological traits14

DNA specimens6

eDNA detections3

Sources9 archives

Databases and archives Astroloba corrugata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF128 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Astroloba corrugata is a small succulent plant of the Astroloba genus, endemic to the Little Karoo and the far south of the Western Cape, South Africa.U. Eggli: Illustrated Handbook of Succulent Plants: Monocotyledons. Springer Science & Business Media, 2001. p.187.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1.04 m

Plant height min0.6 m

Life cycle & reproduction3

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation min500 m

Epiphyteterrestrial

Growth formshrub

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astroloba corrugata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ025350.1 ↗385 bp

ACGT

TGAACCTGCGGAAGGATCATTGTCGAGACCCGAAAGGACGACCGCGAACCATTGATCTCTTTACAGCGAGCGCCCGAGCCTAGCAACGGC …

Astroloba corrugata voucher BHD219 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Astroloba corrugata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · book-ipcn72 · CCDB · book-atlas-flowering-plants · CCDB · kew

CCDB · book-ipcn72 — MAJUMDAR, S.K., & H.P. RILEY. 1972. Chromosome morphology in Astroloba and Poellnitzia. Nucleus 15: 85-91.

CCDB · book-atlas-flowering-plants — Ferguson, 1926

CCDB · kew — Zonneveld BJM. 2015. Nuclear genome sizes of 343 accessions of wild collected Haworthia and Astroloba (Asphodelaceae, Alooideae), compared with the genome sizes of Chortolirion, Gasteria and 83 Aloe species. Plant Systematics and Evolution 301: 931-953.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type128 records

Wild obs. + sensor113

Museum / vouchered15

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 62≤1 km 14≤10 km 3>10 km 23

102 georeferenced · 11 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	12
Research Collection of Bruce Bayerlocation not on record	1
Pretoria, ZA	1

3 institutions · 14 of 15 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Astroloba corrugata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 18.0–18.0

Seasonal swing summer↔winter11.2 °C

Max temp (day)24.4 °C

Min temp (night)12.6 °C

Precipitation40.6 mm/mo

Air humidity55.6 %

Moisture balance-46.2 mm/mo

Vapour deficit912 Pa

Wind speed2.40 m/s

Cloud cover12.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)