Astrocaryum standleyanum

L.H.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Astrocaryum

At a glance

Occurrence records767

Data sources10

Biological traits52

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Astrocaryum standleyanum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility767 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources52 traits

Occurrence & distributionGBIF767 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Astrocaryum standleyanum is a species of palm known by many common names, including chumba wumba, black palm, chonta, chontadura, coquillo, palma negra,Astrocaryum standleyanum L.H. Bailey. Smithsonian Tropical Research Institute Herbarium. pejibaye de montaña,Gargiullo, M., et al. A Field Guide to Plants of Costa Rica. Oxford University Press. 2008. pg. 3. güerre, güérregue, güinul, mocora, pucaishchi (Chachi),Pedersen, H. B. (1994). Mocora palm-fibers: Use and management of Astrocaryum standleyanum (Arecaceae) in Ecuador. Economic Botany 48(3) 310-25. and chunga (Emberá).Macko, A. (2012). Need versus availability of the Astrocaryum standleyanum palm and strategies for future sustainable management in the Ipeti Embera territory, eastern Panama. SIT Graduate Institute Independent Study Project Collection. Paper 1322. It is native to Central and South America, where its distribution extends from Nicaragua to Ecuador. It is most common in central Panama, even becoming abundant in the tropical forests around the Panama Canal, but in general it is not a common plant.Condit, R., et al. Trees of Panama and Costa Rica. Princeton University Press. 2010. pg. 78.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length55 mm

Fruit length max60 mm

Fruit length min40 mm

Fruit width31 mm

Fruit width max35 mm

Fruit width min27 mm

Leaf length max5 610 mm

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 15.02 m

Plant height max15 m

Seed length30 mm

Seed length max30 mm

Seed length min15 mm

Seed mass7 593 mg

Seed volume14 000 mm³

Seed volume max14 000 mm³

Seed volume min14 000 mm³

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit colourorange

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry12

Ldmc max364 mg/g

Ldmc min364 mg/g

Leaf C:N ratio32.08 g/g

Leaf c456 mg/g

Leaf dry-matter content (LDMC)432 mg/g

⚠ sources differ — TRY: 432 mg/g · GIFT: 364 mg/g

Leaf n14.45 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)25.68 mm²/mg

Wood density480 mg/cm³

Wood density max480 mg/cm³

Wood density min480 mg/cm³

Other traits5

Dbh max30 cm

Defenseyes

Leaf spinesyes

Shoot length max1 500 cm

Shoot orientationerect

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrocaryum standleyanum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes5

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT509066.1 ↗253 bpPanama · 2019

ACGT

GAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGATTGAGGAAGACCCGCGAACATGTGAA …

Astrocaryum standleyanum isolate sp54 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★trnL-F★ITS4★ITS2

plant barcodefungal barcode

07Deep time~9.65 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin9.65 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type767 records

Wild obs. + sensor646

Museum / vouchered111

Cultivated / captive10

Origin

Native8

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 70≤1 km 32≤10 km 12>10 km 6

120 georeferenced · 526 without coordinates

Open the mapobservation + sensor646

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 10≤10 km 20>10 km 1

31 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence111

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 9

9 georeferenced · 1 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	24
Universidad Nacional de Colombia (UNAL)location not on record	23
Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record	12
Xiamen, CN	10
National Biodiversity Institute, Costa Ricalocation not on record	8
Bronx, US	3
Kew, GB	3
Miami, US	3
Aarhus, DK	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Universidad Tecnológica del Chocó (UTCH)location not on record	2
Museo Nacional de Costa Rica (MNCR)location not on record	2
Station d'Ecologie de Lamtolocation not on record	2
COLlocation not on record	1
Tampa, US	1
Río Palenque Science Centerlocation not on record	1
San José, CR	1
Richmond, US	1
Universidad de Guayaquillocation not on record	1
Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record	1
ASUlocation not on record	1

21 institutions · 104 of 111 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Astrocaryum standleyanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.90 °C 7.90–7.90

Seasonal swing summer↔winter15.4 °C

Max temp (day)11.0 °C

Min temp (night)4.70 °C

Precipitation75.2 mm/mo

Air humidity65.7 %

Moisture balance14.4 mm/mo

Vapour deficit403 Pa

Wind speed4.10 m/s

Cloud cover58.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)