Astrocaryum murumuru

Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Astrocaryum

At a glance

Occurrence records296

Data sources7

Biological traits42

DNA specimens8

eDNA detections6

Sources7 archives

Databases and archives Astrocaryum murumuru's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility296 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources42 traits

Occurrence & distributionGBIF296 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Astrocaryum murumuru est une espèce de plantes à fleurs de la famille des palmiers à feuilles pennées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length72.5 mm

Fruit length max85 mm

Fruit length min60 mm

Fruit width41 mm

Fruit width max44 mm

Fruit width min38 mm

Leaf length max8 000 mm

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 12.5 m

Plant height max15 m

Seed length37.5 mm

Seed mass9 784 mg

⚠ sources differ — TRY: 9 784 mg · GIFT: 10 400 mg

Seed mass max11 900 mg

Seed mass min7 400 mg

Seed volume13 000 mm³

Seed volume max13 000 mm³

Seed volume min13 000 mm³

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation mean400 m

Epiphyteterrestrial

Fruit colourbrown

Fruit fleshinessfleshy

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry5

Leaf n16.3 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.27 mm²/mg

Wood density508 mg/cm³

Other traits5

Dbh max30 cm

Defenseyes

Leaf spinesyes

Shoot length max1 500 cm

Shoot orientationerect

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrocaryum murumuru has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes6

GenBank sequences10

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK691800.1 ↗494 bp

ACGT

AATTGCAGAATCCCGCGAACCACCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCACCCGGTCGAGGGCACGCCTGCCTGGGCGTCACGC …

Astrocaryum murumuru voucher XMBG015 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★trnL-F★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type296 records

Wild obs. + sensor162

Museum / vouchered134

Origin

Native3

Range

Area of Occupancy AOO576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 22≤1 km 3≤10 km 25>10 km 12

62 georeferenced · 100 without coordinates

Open the mapobservation + sensor162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 8≤10 km 7>10 km 6

21 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	23
Saint Louis, US	23
Bronx, US	13
Aarhus, DK	9
Kew, GB	8
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	5
La Paz, BO	5
Chicago, US	4
Universidade do Estado de Mato Grossolocation not on record	4
Universidad de la Amazonia (UniAmazonia)location not on record	3
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	2
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	2
UEPAlocation not on record	2
USP-IBlocation not on record	1
150location not on record	1
C. Listabarthlocation not on record	1
H. Balslevlocation not on record	1
Universidad de los Andes (UniAndes)location not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
JBRJlocation not on record	1
QCNElocation not on record	1
Santa Cruz de la Sierra, BO	1
Quito, EC	1
ASUlocation not on record	1
Porto Velho, BR	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
Universidad Nacional Agraria La Molina, Herbariolocation not on record	1
Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record	1

29 institutions · 119 of 134 vouchered records shown · 10 without an institution code

09Environmental DNA6 detections

Where the DNA of Astrocaryum murumuru was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 15.9–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)30.0 °C 19.9–30.0

Min temp (night)22.3 °C 12.1–22.3

Precipitation201 mm/mo 64.6–201

Air humidity65.4 % 62.9–65.4

Moisture balance66.9 mm/mo -28.1–66.9

Vapour deficit1,144 Pa 733–1,144

Wind speed1.20 m/s 1.10–3.30

Cloud cover30.7 % 30.7–37.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)