Astrocaryum aculeatum

G.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Astrocaryum

At a glance

Occurrence records381

Data sources7

Biological traits41

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Astrocaryum aculeatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility381 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources41 traits

Occurrence & distributionGBIF381 records

DNA & barcodingNCBIsequences

01Narrative

Astrocaryum gynacanthum est une espèce de palmiers à feuilles pennées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology16

Fruit length40 mm

Fruit length max65 mm

Fruit length min45 mm

Fruit width28 mm

Fruit width max45 mm

Fruit width min35 mm

Leaf length max8 400 mm

Plant height11.5 m

⚠ sources differ — GIFT: 11.5 m · TRY: 20 m

Plant height max20 m

Seed length36 mm

Seed mass1 830 mg

⚠ sources differ — TRY: 1 830 mg · GIFT: 8 242 mg

Seed mass max17 720 mg

Seed mass min1 240 mg

Seed volume11 600 mm³

Seed volume max19 000 mm³

Seed volume min4 200 mm³

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climberself-supporting

Elevation max350 m

Elevation mean100 m

Elevation min100 m

Epiphyteterrestrial

Fruit colourorange

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Palm

Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits5

Dbh max25 cm

Defenseyes

Leaf spinesyes

Shoot length max2 000 cm

Shoot orientationerect

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrocaryum aculeatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMH537788.1 ↗156 804 bp

ACGT

CTAATACTTATACTTATTTTATTACTTATGTGTGCAAAACACTATTGAATCAAACAATGGAGCAATACCCAACTAAAACAAGATATTGGG …

Astrocaryum aculeatum chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type381 records

Wild obs. + sensor280

Museum / vouchered101

Origin

Native5

Range

Area of Occupancy AOO664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 128≤1 km 17≤10 km 4>10 km 9

158 georeferenced · 122 without coordinates

Open the mapobservation + sensor280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 4>10 km 1

6 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	26
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	16
Saint Louis, US	8
Universidad Nacional de Colombia (UNAL)location not on record	7
Universidade do Estado de Mato Grossolocation not on record	4
JBRJlocation not on record	3
Xiamen, CN	2
Institut fur Allgemeine Mikrobiologielocation not on record	2
Foz do Iguaçu, BR	2
ACT-Slocation not on record	2
La Paz, BO	2
Wlocation not on record	2
University of Stellenboschlocation not on record	2
Chicago, US	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Kew, GB	1
Brasília, BR	1
Porto Velho, BR	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Cuiabá, BR	1
Santa Cruz de la Sierra, BO	1
Cenargenlocation not on record	1
LDlocation not on record	1
Miami, US	1
UNICAMPlocation not on record	1

25 institutions · 90 of 101 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)