Astrocaryum aculeatissimum

(Schott) Burret · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Astrocaryum

At a glance

Occurrence records462

Data sources7

Biological traits39

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Astrocaryum aculeatissimum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility462 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources39 traits

Occurrence & distributionGBIF462 records

DNA & barcodingNCBIsequences

01Narrative

Astrocaryum aculeatissimum (syn. Astrocaryum ayri Mart., Toxophoenix aculeatissima Schott) is a palm native to Atlantic Coast restingas vegetation, which is an ecosystem of Atlantic Forest biome in Brazil. This plant has a commercial value because it has useful fibers which may be used to make production of brooms. The trunk of the tree is covered by rings of very sharp spines, believed by some biologists to have evolved as protection against the extinct Megatherium Giant Ground Sloth.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length55 mm

Fruit length max60 mm

Fruit length min50 mm

Fruit width35 mm

Fruit width max40 mm

Fruit width min30 mm

Plant height8 m

Plant height max8 m

Seed length42.7 mm

Seed mass11 430 mg

Seed volume16 000 mm³

Seed volume max16 000 mm³

Seed volume min16 000 mm³

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max100 m

Elevation min0 m

Epiphyteterrestrial

Fruit colourbrown

Fruit fleshinessfleshy

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry3

Leaf dry-matter content (LDMC)447 mg/g

Nitrogen fixingnon_nitrogen_fixer

Wood density232 mg/cm³

Other traits5

Dbh max15 cm

Defenseyes

Leaf spinesyes

Shoot length max800 cm

Shoot orientationerect

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrocaryum aculeatissimum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF981200.1 ↗699 bpBrazil · 2011

ACGT

GCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCA …

Astrocaryum aculeatissimum isolate PEIC010 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3

plant barcode

08Occurrence & distribution

Record type462 records

Wild obs. + sensor305

Museum / vouchered134

Other23

Origin

Native63

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 59≤1 km 22≤10 km 11>10 km 6

98 georeferenced · 207 without coordinates

Open the mapobservation + sensor305

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INMAlocation not on record	22
Bronx, US	17
Campo Mourão, BR	10
JBRJlocation not on record	7
Universidade Federal do Espírito Santolocation not on record	6
San Jose State University, Museum of Birds and Mammalslocation not on record	5
UNICAMPlocation not on record	5
UFRRJlocation not on record	5
USP-IBlocation not on record	5
CEPLAClocation not on record	4
Kew, GB	3
PUC-RIOlocation not on record	3
Ivano-Frankivsk, UA	3
HUENFlocation not on record	3
ESALQlocation not on record	3
UFESlocation not on record	3
Seropédica, BR	2
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	2
IPA/SPlocation not on record	2
Departamento de Geologia, Universidad de Chilelocation not on record	2
Universidade de São Paulolocation not on record	2
University of Stellenboschlocation not on record	2
Istituto Agrario Castelnuovolocation not on record	2
UTFPR-CPlocation not on record	2
CPATSAlocation not on record	1
Institut fur Allgemeine Mikrobiologielocation not on record	1
Universidade Federal do Maranhãolocation not on record	1
UFPRlocation not on record	1
Federal University of Espírito Santolocation not on record	1
UFMGlocation not on record	1
Saint Louis, US	1
UNESP-FCAlocation not on record	1
Bogotá, D.C., CO	1

33 institutions · 129 of 134 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)