Astrebla pectinata

(Lindl.) F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Astrebla

At a glance

Occurrence records3 394

Data sources9

Biological traits32

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Astrebla pectinata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF3 394 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Astrebla pectinata, commonly known as barley Mitchell grass, is a herb of the family Poaceae from the order Poales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf length123 mm

Leaf mass63.53 mg

Leaf mass per area88.17 g/m2

Leaf size544 mm²

Leaf width3 mm

Plant height0.65 m

⚠ sources differ — AusTraits: 0.65 m · TRY: 1.2 m

Plant height max1 m

Plant height min0.3 m

Seed mass1.86 mg

⚠ sources differ — TRY: 1.86 mg · AusTraits: 1.31 mg · GIFT: 2.4 mg

Seed mass max5.7 mg

Seed mass min1.06 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timeyyyyynnnyyyy

Life formperennial

Life spanperennial

Pollination syndromeself+wind

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrebla pectinata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ219610.1 ↗589 bpAustralia

ACGT

TCGTGACCCTGACCAACACAGACCGTGAACGTGTCATCTATGCCGCCGAGTGACGGGACTTGCACCCGTCGCTCGGTAGTGGCCACCGAC …

Astrebla pectinata voucher PI238232 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astrebla pectinata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · Cave1957

CCDB · Cave1957 — Tateoka b

08Occurrence & distribution

Record type3 394 records

Wild obs. + sensor2 024

Museum / vouchered1 116

Cultivated / captive1

Other253

Origin

Native893

Introduced2

Range

Area of Occupancy AOO9 548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 423≤1 km 131≤10 km 48>10 km 6

1 608 georeferenced · 416 without coordinates

Open the mapobservation + sensor2 024

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 215≤1 km 177≤10 km 425>10 km 225

1 042 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence1 116

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	268
Brisbane, AU	224
Palmerston, AU	165
Canberra, AU	152
Mount Annan, AU	66
Kensington, AU	58
Museo Entomologico de Leonlocation not on record	53
Saint Louis, US	10
Armidale, AU	7
John T. Waterhouse Herbariumlocation not on record	6
Smithfield, AU	5
James Cook Townsvillelocation not on record	5
Hobart, AU	4
Kew, GB	3
Auckland, NZ	3
Claremont, US	3
Department of Land Resources Managementlocation not on record	2
BGPAlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Dekalb, US	1
University of Stellenboschlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
Pretoria, ZA	1
EL PASO, US	1
La Trobe Universitylocation not on record	1

25 institutions · 1 043 of 1 116 vouchered records shown · 71 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Astrebla pectinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astrebla pectinata

At a glance

Sources9 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 394 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 394 records