Astrebla elymoides

F.Muell. ex F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Astrebla

At a glance

Occurrence records1 347

Data sources8

Biological traits31

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Astrebla elymoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 347 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF1 347 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Astrebla elymoides, commonly known as hoop Mitchell grass, is a herb of the family Poaceae. Named in honour of Thomas Mitchell, it is regarded as the best of the Astrebla grasses for grazing, particularly for cattle. Often seen growing to one metre tall, on floodplains and heavy self mulching clay soils in arid to semi arid Australia. Flowering is in response to rain or flooding.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length5 mm

Leaf length185 mm

Leaf size324 mm²

Leaf width4 mm

Plant height0.9 m

Plant height max1 m

Plant height min0.6 m

Seed mass6.22 mg

⚠ sources differ — TRY: 6.22 mg · AusTraits: 5.44 mg · GIFT: 6.12 mg

Seed mass max6.82 mg

Seed mass min5.43 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timeyyyyynnnyyyy

Life formperennial

Life spanperennial

Pollination syndromewind

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrebla elymoides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU359269.1 ↗667 bpAustralia

ACGT

TGACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACTGTGAACATGTCATCTATGCCACCGGGTGATGGGACTTGCACCTAT …

Astrebla elymoides voucher US:Hubbard 7976 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type1 347 records

Wild obs. + sensor690

Museum / vouchered463

Other194

Origin

Native63

Introduced1

Range

Area of Occupancy AOO3 872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 402≤1 km 4≤10 km 32

438 georeferenced · 252 without coordinates

Open the mapobservation + sensor690

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 80≤1 km 12≤10 km 216>10 km 105

413 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence463

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	142
Canberra, AU	107
Palmerston, AU	68
Mount Annan, AU	53
Kensington, AU	30
Museo Entomologico de Leonlocation not on record	15
Adelaide, AU	12
Saint Louis, US	6
Armidale, AU	5
Smithfield, AU	5
University of Stellenboschlocation not on record	3
Bloomington, US	3
James Cook Townsvillelocation not on record	2
Kew, GB	2
Auckland, NZ	2
Austin, US	2
Claremont, US	1
Berlin, DE	1
ASUlocation not on record	1
BGPAlocation not on record	1
La Trobe Universitylocation not on record	1

21 institutions · 462 of 463 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Astrebla elymoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astrebla elymoides

At a glance

Sources8 archives

Size & morphology10

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Record type1 347 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 347 records