Astrantia maxima

Pall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Astrantia

At a glance

Occurrence records797

Data sources9

Biological traits19

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Astrantia maxima's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility797 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF797 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

Astrantia maxima, (largest masterwort), is a species of flowering plant in the family Apiaceae. Growing to 90 cm tall by 60 cm broad, it is an herbaceous perennial, used in gardens. It is hardy to USDA Zone: 4-9. It has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.4 m

Plant height max0.7 m

Plant height min0.4 m

Seed mass3.0 mg

⚠ sources differ — TRY: 3.0 mg · GIFT: 2.8 mg

Seed mass max2.8 mg

Seed mass min2.8 mg

Life cycle & reproduction4

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows, mountains

Mycorrhiza typearbuscular

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrantia maxima has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPQ457032.1 ↗496 bpTurkey

ACGT

CCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAA …

Astrantia maxima subsp. maxima voucher ADK 3297 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Astrantia maxima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Gvinianidze, Z. I. & A. A. Avazneli. 1982. Khromosomnye chisla nekotorykh predstavitelej vysokogornykh floristicheskikh kompleksov Kavkaza. Soobkskc. Akad. Nauk Gruzinskoi SSR, Inst. Bot., Trudy, Ser. Geobot. 106 (3): 577–580.

CCDB · book-fedorov — Wanscher 1932

CCDB · book-fedorov — Coi\O.)iODCNaJI, CTpenkoBa 19486

CCDB · book-fedorov — Garde, Malheiros-Garde 1954

CCDB · book-atlas-flowering-plants — Wanscher 1932

n 71×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pimenov, M. G., J. V. Dauschkevich, M. G. Vasil'eva & E. V. Kljuykov. 1996. Mediterranean chromosome number reports 6 (716--748). Fl. Medit. 6: 288–307.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type797 records

Wild obs. + sensor627

Museum / vouchered165

Cultivated / captive5

Origin

Native1

Range

Area of Occupancy AOO1 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 298≤1 km 90≤10 km 35>10 km 23

446 georeferenced · 181 without coordinates

Open the mapobservation + sensor627

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 4≤1 km 22≤10 km 46

72 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence165

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	131
Wlocation not on record	11
BRNUlocation not on record	6
Bronx, US	3
Salamanca, ES	3
Edinburgh, GB	2
GJOlocation not on record	1
Denver, US	1
Berlin, DE	1
Kew, GB	1
South Kensington, GB	1
València, ES	1

12 institutions · 162 of 165 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)